Mutagenetix > Incidental Mutation

Incidental Mutation 'R2904:Card11'

261576

Institutional Source

Beutler Lab

Gene Symbol

Card11

Ensembl Gene

ENSMUSG00000036526

Gene Name

caspase recruitment domain family, member 11

Synonyms

2410011D02Rik, BIMP3, CARMA1, 0610008L17Rik

MMRRC Submission

040491-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2904 (G1)

Quality Score

165

Status

Not validated

Chromosome

Chromosomal Location

140858745-140986337 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 140874888 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 592 (D592V)

Ref Sequence

ENSEMBL: ENSMUSP00000082941 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085786]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000085786
AA Change: D592V

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000082941
Gene: ENSMUSG00000036526
AA Change: D592V

Domain	Start	End	E-Value	Type
Pfam:CARD	23	109	1.3e-23	PFAM
coiled coil region	176	440	N/A	INTRINSIC
low complexity region	475	487	N/A	INTRINSIC
low complexity region	535	549	N/A	INTRINSIC
low complexity region	615	625	N/A	INTRINSIC
PDZ	674	755	2.73e-1	SMART
Blast:SH3	776	838	1e-10	BLAST
low complexity region	839	850	N/A	INTRINSIC
low complexity region	920	934	N/A	INTRINSIC
SCOP:d1kjwa2	970	1149	1e-18	SMART
Blast:GuKc	973	1139	1e-102	BLAST

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

97% (30/31)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the membrane-associated guanylate kinase (MAGUK) family, a class of proteins that functions as molecular scaffolds for the assembly of multiprotein complexes at specialized regions of the plasma membrane. This protein is also a member of the CARD protein family, which is defined by carrying a characteristic caspase-associated recruitment domain (CARD). This protein has a domain structure similar to that of CARD14 protein. The CARD domains of both proteins have been shown to specifically interact with BCL10, a protein known to function as a positive regulator of cell apoptosis and NF-kappaB activation. When expressed in cells, this protein activated NF-kappaB and induced the phosphorylation of BCL10. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit defects in antigen receptor signalling in both T and B lymphocytes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abraxas1	T	C	5: 100,957,673 (GRCm39)	E182G	probably benign	Het
Acot4	C	G	12: 84,090,377 (GRCm39)	T358S	probably benign	Het
Ap2a2	A	G	7: 141,199,391 (GRCm39)	K433E	probably damaging	Het
Col12a1	G	T	9: 79,559,307 (GRCm39)	S1860R	probably damaging	Het
Crisp1	C	T	17: 40,623,895 (GRCm39)		probably null	Het
Dzip1l	A	G	9: 99,545,722 (GRCm39)	E657G	probably damaging	Het
Gak	T	C	5: 108,772,080 (GRCm39)	N79S	possibly damaging	Het
Gm9791	T	C	3: 34,059,336 (GRCm39)		noncoding transcript	Het
Gmpr2	T	C	14: 55,910,215 (GRCm39)	V15A	probably damaging	Het
Hectd4	T	C	5: 121,430,787 (GRCm39)		probably benign	Het
Ift56	T	C	6: 38,378,037 (GRCm39)	V283A	possibly damaging	Het
Kalrn	C	T	16: 33,810,180 (GRCm39)	D2525N	possibly damaging	Het
Kdm4b	G	A	17: 56,662,884 (GRCm39)	G152S	probably benign	Het
Kdm6b	G	A	11: 69,296,611 (GRCm39)	T552I	possibly damaging	Het
Kdr	T	C	5: 76,127,069 (GRCm39)	Y307C	probably damaging	Het
Kif11	T	C	19: 37,392,103 (GRCm39)		probably benign	Het
Kirrel1	C	T	3: 86,996,458 (GRCm39)	M380I	probably null	Het
Madd	C	T	2: 91,006,017 (GRCm39)	V20M	probably damaging	Het
Mkrn3	C	A	7: 62,068,207 (GRCm39)	R528L	probably benign	Het
Myom2	T	C	8: 15,148,348 (GRCm39)	V508A	probably benign	Het
Nav1	T	C	1: 135,512,976 (GRCm39)	D28G	probably benign	Het
Nlrp4b	T	A	7: 10,448,294 (GRCm39)	W166R	probably damaging	Het
Or14j2	A	T	17: 37,885,705 (GRCm39)	L203Q	possibly damaging	Het
Or5p59	T	C	7: 107,702,806 (GRCm39)	Y97H	probably benign	Het
Rassf10	A	T	7: 112,553,756 (GRCm39)	D119V	possibly damaging	Het
Smarcc1	A	G	9: 110,003,043 (GRCm39)	N378D	possibly damaging	Het
Tas2r118	A	G	6: 23,969,801 (GRCm39)	F87L	possibly damaging	Het
Tasor2	T	C	13: 3,632,185 (GRCm39)	N772S	possibly damaging	Het
Trim21	A	G	7: 102,209,178 (GRCm39)	W282R	probably benign	Het
Uggt2	T	A	14: 119,296,521 (GRCm39)	Y447F	possibly damaging	Het
Zfp160	G	A	17: 21,245,911 (GRCm39)	V154I	probably benign	Het

Other mutations in Card11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
unmodulated	APN	5	140,897,997 (GRCm38)	intron	probably benign
IGL00961:Card11	APN	5	140,885,464 (GRCm39)	missense	probably damaging	0.97
IGL01645:Card11	APN	5	140,863,778 (GRCm39)	missense	probably benign	0.00
IGL01731:Card11	APN	5	140,868,057 (GRCm39)	missense	possibly damaging	0.89
IGL01782:Card11	APN	5	140,913,481 (GRCm39)	start codon destroyed	probably null	0.02
IGL01935:Card11	APN	5	140,869,301 (GRCm39)	missense	possibly damaging	0.62
IGL01991:Card11	APN	5	140,899,133 (GRCm39)	missense	possibly damaging	0.63
IGL02447:Card11	APN	5	140,892,679 (GRCm39)	missense	possibly damaging	0.93
IGL02583:Card11	APN	5	140,863,881 (GRCm39)	missense	probably benign	0.10
IGL03255:Card11	APN	5	140,884,086 (GRCm39)	missense	possibly damaging	0.73
Ace	UTSW	5	140,888,632 (GRCm39)	missense	possibly damaging	0.70
Caravaggio	UTSW	5	140,899,064 (GRCm39)	missense	probably damaging	1.00
Dealer	UTSW	5	140,871,632 (GRCm39)	missense	probably damaging	1.00
Dogs	UTSW	5	140,867,755 (GRCm39)	critical splice donor site	probably null
Face	UTSW	5	140,886,732 (GRCm39)	missense	probably damaging	1.00
hubei	UTSW	5	140,892,522 (GRCm39)	missense	probably damaging	0.96
king	UTSW	5	140,876,835 (GRCm39)	splice site	probably benign
may	UTSW	5	140,862,250 (GRCm39)	nonsense	probably null
Poker	UTSW	5	140,863,837 (GRCm39)	missense	probably benign
Sharp	UTSW	5	140,862,180 (GRCm39)	missense	possibly damaging	0.93
Tumnus	UTSW	5	140,871,700 (GRCm39)	missense	possibly damaging	0.75
unmodulated2	UTSW	5	140,869,537 (GRCm39)	splice site	probably null
PIT4243001:Card11	UTSW	5	140,894,359 (GRCm39)	missense	possibly damaging	0.95
PIT4486001:Card11	UTSW	5	140,862,163 (GRCm39)	missense	probably damaging	1.00
PIT4531001:Card11	UTSW	5	140,892,415 (GRCm39)	missense	probably damaging	0.99
R0046:Card11	UTSW	5	140,894,279 (GRCm39)	missense	possibly damaging	0.92
R0285:Card11	UTSW	5	140,872,856 (GRCm39)	missense	probably damaging	1.00
R0452:Card11	UTSW	5	140,866,125 (GRCm39)	missense	probably benign	0.01
R1486:Card11	UTSW	5	140,862,274 (GRCm39)	missense	probably benign
R1710:Card11	UTSW	5	140,888,660 (GRCm39)	nonsense	probably null
R1733:Card11	UTSW	5	140,892,388 (GRCm39)	missense	possibly damaging	0.88
R1817:Card11	UTSW	5	140,871,315 (GRCm39)	missense	probably benign	0.00
R1818:Card11	UTSW	5	140,871,315 (GRCm39)	missense	probably benign	0.00
R2027:Card11	UTSW	5	140,892,522 (GRCm39)	missense	probably damaging	0.96
R2436:Card11	UTSW	5	140,868,117 (GRCm39)	missense	possibly damaging	0.89
R3706:Card11	UTSW	5	140,872,890 (GRCm39)	missense	probably damaging	0.99
R3708:Card11	UTSW	5	140,872,890 (GRCm39)	missense	probably damaging	0.99
R4778:Card11	UTSW	5	140,869,537 (GRCm39)	splice site	probably null
R4877:Card11	UTSW	5	140,871,632 (GRCm39)	missense	probably damaging	1.00
R4889:Card11	UTSW	5	140,871,700 (GRCm39)	missense	possibly damaging	0.75
R4910:Card11	UTSW	5	140,860,169 (GRCm39)	missense	probably damaging	1.00
R5011:Card11	UTSW	5	140,862,275 (GRCm39)	missense	possibly damaging	0.93
R5257:Card11	UTSW	5	140,862,180 (GRCm39)	missense	possibly damaging	0.93
R5258:Card11	UTSW	5	140,862,180 (GRCm39)	missense	possibly damaging	0.93
R5682:Card11	UTSW	5	140,888,666 (GRCm39)	nonsense	probably null
R5754:Card11	UTSW	5	140,885,524 (GRCm39)	missense	probably damaging	0.99
R5873:Card11	UTSW	5	140,894,393 (GRCm39)	missense	probably damaging	1.00
R6184:Card11	UTSW	5	140,884,033 (GRCm39)	missense	probably damaging	1.00
R6792:Card11	UTSW	5	140,899,064 (GRCm39)	missense	probably damaging	1.00
R6825:Card11	UTSW	5	140,863,837 (GRCm39)	missense	probably benign
R7008:Card11	UTSW	5	140,859,148 (GRCm39)	missense	probably damaging	1.00
R7291:Card11	UTSW	5	140,886,825 (GRCm39)	missense	probably damaging	1.00
R7376:Card11	UTSW	5	140,883,993 (GRCm39)	missense	probably benign	0.01
R7526:Card11	UTSW	5	140,899,184 (GRCm39)	splice site	probably null
R7683:Card11	UTSW	5	140,881,781 (GRCm39)	missense	probably benign
R7730:Card11	UTSW	5	140,871,751 (GRCm39)	missense	probably damaging	0.96
R7813:Card11	UTSW	5	140,885,419 (GRCm39)	missense	probably damaging	1.00
R7831:Card11	UTSW	5	140,859,167 (GRCm39)	missense	possibly damaging	0.61
R7911:Card11	UTSW	5	140,867,755 (GRCm39)	critical splice donor site	probably null
R8154:Card11	UTSW	5	140,886,732 (GRCm39)	missense	probably damaging	1.00
R8224:Card11	UTSW	5	140,888,632 (GRCm39)	missense	possibly damaging	0.70
R8272:Card11	UTSW	5	140,875,794 (GRCm39)	missense	probably damaging	1.00
R8714:Card11	UTSW	5	140,899,147 (GRCm39)	missense	possibly damaging	0.67
R8715:Card11	UTSW	5	140,871,315 (GRCm39)	missense	probably benign	0.00
R9065:Card11	UTSW	5	140,894,297 (GRCm39)	missense	probably damaging	1.00
R9211:Card11	UTSW	5	140,869,375 (GRCm39)	missense	probably benign	0.16
R9215:Card11	UTSW	5	140,866,154 (GRCm39)	missense	possibly damaging	0.64
R9269:Card11	UTSW	5	140,892,516 (GRCm39)	missense	probably damaging	0.99
R9385:Card11	UTSW	5	140,871,276 (GRCm39)	missense	probably benign	0.44
R9421:Card11	UTSW	5	140,869,462 (GRCm39)	missense	probably damaging	0.97
R9424:Card11	UTSW	5	140,894,395 (GRCm39)	missense	probably damaging	1.00
R9444:Card11	UTSW	5	140,894,393 (GRCm39)	missense	probably damaging	1.00
V7732:Card11	UTSW	5	140,862,250 (GRCm39)	nonsense	probably null
X0067:Card11	UTSW	5	140,871,347 (GRCm39)	missense	possibly damaging	0.60
Z1177:Card11	UTSW	5	140,883,996 (GRCm39)	missense	probably benign	0.43

Predicted Primers

PCR Primer
(F):5'- GCTCTGCCTATAAACCACAGAG -3'
(R):5'- AGGGCAGCCTTCCTACTTCC -3'

Sequencing Primer
(F):5'- ACAGAGCCAGCTTAGTCTCTG -3'
(R):5'- GGCAGCCTTCCTACTTCCTTACTTC -3'

Posted On

2015-01-23