Incidental Mutation 'R2904:Nlrp4b'
ID261579
Institutional Source Beutler Lab
Gene Symbol Nlrp4b
Ensembl Gene ENSMUSG00000034087
Gene NameNLR family, pyrin domain containing 4B
SynonymsNalp4b, Nalp-gamma
MMRRC Submission 040491-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R2904 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location10687789-10730168 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 10714367 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 166 (W166R)
Ref Sequence ENSEMBL: ENSMUSP00000113095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047809] [ENSMUST00000117413] [ENSMUST00000132990] [ENSMUST00000211069]
Predicted Effect probably damaging
Transcript: ENSMUST00000047809
AA Change: W166R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043881
Gene: ENSMUSG00000034087
AA Change: W166R

DomainStartEndE-ValueType
PYRIN 6 89 1.4e-20 SMART
Pfam:NACHT 143 312 7.9e-40 PFAM
low complexity region 520 535 N/A INTRINSIC
LRR 683 710 4.9e0 SMART
LRR 712 739 1.97e0 SMART
LRR 740 767 1.13e-4 SMART
LRR 769 796 1.93e1 SMART
LRR 797 824 1.73e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117413
AA Change: W166R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113095
Gene: ENSMUSG00000034087
AA Change: W166R

DomainStartEndE-ValueType
PYRIN 6 89 1.4e-20 SMART
Pfam:NACHT 143 312 3.3e-39 PFAM
low complexity region 520 535 N/A INTRINSIC
LRR 683 710 4.9e0 SMART
LRR 712 739 1.97e0 SMART
LRR 740 767 1.13e-4 SMART
LRR 769 796 1.93e1 SMART
LRR 797 824 1.73e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132990
SMART Domains Protein: ENSMUSP00000115831
Gene: ENSMUSG00000034087

DomainStartEndE-ValueType
low complexity region 153 168 N/A INTRINSIC
LRR 316 343 4.9e0 SMART
LRR 345 372 1.97e0 SMART
LRR 373 400 1.13e-4 SMART
LRR 402 429 1.93e1 SMART
LRR 430 457 1.73e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211069
Predicted Effect probably benign
Transcript: ENSMUST00000211258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211772
Meta Mutation Damage Score 0.8627 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 T C 5: 100,809,807 E182G probably benign Het
Acot4 C G 12: 84,043,603 T358S probably benign Het
Ap2a2 A G 7: 141,619,478 K433E probably damaging Het
Card11 T A 5: 140,889,133 D592V probably benign Het
Col12a1 G T 9: 79,652,025 S1860R probably damaging Het
Crisp1 C T 17: 40,313,004 probably null Het
Dzip1l A G 9: 99,663,669 E657G probably damaging Het
Fam208b T C 13: 3,582,185 N772S possibly damaging Het
Gak T C 5: 108,624,214 N79S possibly damaging Het
Gm9791 T C 3: 34,005,187 noncoding transcript Het
Gmpr2 T C 14: 55,672,758 V15A probably damaging Het
Hectd4 T C 5: 121,292,724 probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kdm4b G A 17: 56,355,884 G152S probably benign Het
Kdm6b G A 11: 69,405,785 T552I possibly damaging Het
Kdr T C 5: 75,966,409 Y307C probably damaging Het
Kif11 T C 19: 37,403,655 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Madd C T 2: 91,175,672 V20M probably damaging Het
Mkrn3 C A 7: 62,418,459 R528L probably benign Het
Myom2 T C 8: 15,098,348 V508A probably benign Het
Nav1 T C 1: 135,585,238 D28G probably benign Het
Olfr113 A T 17: 37,574,814 L203Q possibly damaging Het
Olfr483 T C 7: 108,103,599 Y97H probably benign Het
Rassf10 A T 7: 112,954,549 D119V possibly damaging Het
Smarcc1 A G 9: 110,173,975 N378D possibly damaging Het
Tas2r118 A G 6: 23,969,802 F87L possibly damaging Het
Trim21 A G 7: 102,559,971 W282R probably benign Het
Ttc26 T C 6: 38,401,102 V283A possibly damaging Het
Uggt2 T A 14: 119,059,109 Y447F possibly damaging Het
Zfp160 G A 17: 21,025,649 V154I probably benign Het
Other mutations in Nlrp4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Nlrp4b APN 7 10714955 missense possibly damaging 0.68
IGL01456:Nlrp4b APN 7 10714223 missense probably benign 0.26
IGL01537:Nlrp4b APN 7 10714991 missense probably damaging 1.00
IGL02539:Nlrp4b APN 7 10714428 missense probably damaging 0.96
IGL02730:Nlrp4b APN 7 10714758 missense probably damaging 1.00
IGL02871:Nlrp4b APN 7 10715265 missense probably benign 0.26
IGL03008:Nlrp4b APN 7 10714589 missense probably benign 0.00
IGL03109:Nlrp4b APN 7 10714946 missense probably damaging 1.00
IGL03251:Nlrp4b APN 7 10714500 missense probably benign 0.01
IGL03354:Nlrp4b APN 7 10714538 missense probably damaging 0.99
R0052:Nlrp4b UTSW 7 10725962 nonsense probably null
R0348:Nlrp4b UTSW 7 10715181 missense possibly damaging 0.60
R0564:Nlrp4b UTSW 7 10714658 missense probably benign 0.15
R0573:Nlrp4b UTSW 7 10714215 missense probably benign 0.01
R0581:Nlrp4b UTSW 7 10714530 missense probably damaging 1.00
R1201:Nlrp4b UTSW 7 10715436 missense possibly damaging 0.64
R1541:Nlrp4b UTSW 7 10725052 missense possibly damaging 0.91
R1771:Nlrp4b UTSW 7 10718593 missense probably damaging 0.96
R1781:Nlrp4b UTSW 7 10715339 missense probably benign 0.13
R1833:Nlrp4b UTSW 7 10725936 missense probably benign 0.00
R2405:Nlrp4b UTSW 7 10714728 missense probably benign 0.08
R2871:Nlrp4b UTSW 7 10710243 nonsense probably null
R2871:Nlrp4b UTSW 7 10710243 nonsense probably null
R2873:Nlrp4b UTSW 7 10710243 nonsense probably null
R3410:Nlrp4b UTSW 7 10715529 missense probably damaging 1.00
R3714:Nlrp4b UTSW 7 10714881 missense probably benign 0.04
R3982:Nlrp4b UTSW 7 10714431 missense possibly damaging 0.95
R4668:Nlrp4b UTSW 7 10714733 missense possibly damaging 0.66
R4690:Nlrp4b UTSW 7 10719203 missense probably benign 0.00
R4857:Nlrp4b UTSW 7 10715298 missense probably benign 0.05
R5247:Nlrp4b UTSW 7 10714218 missense probably benign 0.21
R5381:Nlrp4b UTSW 7 10715245 nonsense probably null
R5529:Nlrp4b UTSW 7 10714946 missense possibly damaging 0.91
R5589:Nlrp4b UTSW 7 10715585 missense probably benign 0.34
R5770:Nlrp4b UTSW 7 10715487 missense probably benign 0.00
R5990:Nlrp4b UTSW 7 10714491 missense possibly damaging 0.61
R6049:Nlrp4b UTSW 7 10714713 nonsense probably null
R6329:Nlrp4b UTSW 7 10724920 missense probably benign 0.16
R6377:Nlrp4b UTSW 7 10715412 missense probably benign 0.00
R7107:Nlrp4b UTSW 7 10715217 missense probably damaging 0.96
R7209:Nlrp4b UTSW 7 10710370 missense probably benign 0.01
R7237:Nlrp4b UTSW 7 10715216 missense probably benign 0.12
R7537:Nlrp4b UTSW 7 10714889 missense probably benign 0.05
R7793:Nlrp4b UTSW 7 10725074 missense probably benign 0.00
X0063:Nlrp4b UTSW 7 10729587 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTAAAGGAGAAGCTGACCCATG -3'
(R):5'- GGGTAACATTCCATTCCATCCC -3'

Sequencing Primer
(F):5'- GAGAAGCTGACCCATGATTGTTC -3'
(R):5'- ATCCCTTCTAAGCTGTCAATGATG -3'
Posted On2015-01-23