Incidental Mutation 'R2904:Gmpr2'
ID261594
Institutional Source Beutler Lab
Gene Symbol Gmpr2
Ensembl Gene ENSMUSG00000002326
Gene Nameguanosine monophosphate reductase 2
Synonyms
MMRRC Submission 040491-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock #R2904 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location55671941-55679200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55672758 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 15 (V15A)
Ref Sequence ENSEMBL: ENSMUSP00000154721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002397] [ENSMUST00000010520] [ENSMUST00000163750] [ENSMUST00000227178] [ENSMUST00000227842] [ENSMUST00000227914]
Predicted Effect probably damaging
Transcript: ENSMUST00000002397
AA Change: V15A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002397
Gene: ENSMUSG00000002326
AA Change: V15A

DomainStartEndE-ValueType
IMPDH 8 347 7.5e-147 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000010520
SMART Domains Protein: ENSMUSP00000010520
Gene: ENSMUSG00000010376

DomainStartEndE-ValueType
UBQ 1 72 3.94e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163750
SMART Domains Protein: ENSMUSP00000130492
Gene: ENSMUSG00000010376

DomainStartEndE-ValueType
UBQ 1 72 3.94e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226787
Predicted Effect probably benign
Transcript: ENSMUST00000226819
Predicted Effect probably damaging
Transcript: ENSMUST00000227178
AA Change: V15A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227696
Predicted Effect probably benign
Transcript: ENSMUST00000227842
Predicted Effect probably damaging
Transcript: ENSMUST00000227914
AA Change: V15A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228414
Meta Mutation Damage Score 0.8878 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 T C 5: 100,809,807 E182G probably benign Het
Acot4 C G 12: 84,043,603 T358S probably benign Het
Ap2a2 A G 7: 141,619,478 K433E probably damaging Het
Card11 T A 5: 140,889,133 D592V probably benign Het
Col12a1 G T 9: 79,652,025 S1860R probably damaging Het
Crisp1 C T 17: 40,313,004 probably null Het
Dzip1l A G 9: 99,663,669 E657G probably damaging Het
Fam208b T C 13: 3,582,185 N772S possibly damaging Het
Gak T C 5: 108,624,214 N79S possibly damaging Het
Gm9791 T C 3: 34,005,187 noncoding transcript Het
Hectd4 T C 5: 121,292,724 probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kdm4b G A 17: 56,355,884 G152S probably benign Het
Kdm6b G A 11: 69,405,785 T552I possibly damaging Het
Kdr T C 5: 75,966,409 Y307C probably damaging Het
Kif11 T C 19: 37,403,655 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Madd C T 2: 91,175,672 V20M probably damaging Het
Mkrn3 C A 7: 62,418,459 R528L probably benign Het
Myom2 T C 8: 15,098,348 V508A probably benign Het
Nav1 T C 1: 135,585,238 D28G probably benign Het
Nlrp4b T A 7: 10,714,367 W166R probably damaging Het
Olfr113 A T 17: 37,574,814 L203Q possibly damaging Het
Olfr483 T C 7: 108,103,599 Y97H probably benign Het
Rassf10 A T 7: 112,954,549 D119V possibly damaging Het
Smarcc1 A G 9: 110,173,975 N378D possibly damaging Het
Tas2r118 A G 6: 23,969,802 F87L possibly damaging Het
Trim21 A G 7: 102,559,971 W282R probably benign Het
Ttc26 T C 6: 38,401,102 V283A possibly damaging Het
Uggt2 T A 14: 119,059,109 Y447F possibly damaging Het
Zfp160 G A 17: 21,025,649 V154I probably benign Het
Other mutations in Gmpr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Gmpr2 APN 14 55675714 missense probably damaging 0.98
IGL00949:Gmpr2 APN 14 55676750 splice site probably benign
IGL02348:Gmpr2 APN 14 55678301 missense probably damaging 1.00
R0092:Gmpr2 UTSW 14 55677945 missense probably benign 0.36
R0197:Gmpr2 UTSW 14 55672735 missense possibly damaging 0.83
R0323:Gmpr2 UTSW 14 55672746 missense probably damaging 0.99
R0594:Gmpr2 UTSW 14 55677988 missense probably damaging 1.00
R1366:Gmpr2 UTSW 14 55676743 splice site probably benign
R4996:Gmpr2 UTSW 14 55676795 missense probably damaging 0.99
R5407:Gmpr2 UTSW 14 55678276 missense possibly damaging 0.72
R5695:Gmpr2 UTSW 14 55677234 missense possibly damaging 0.77
R6721:Gmpr2 UTSW 14 55672734 missense probably damaging 1.00
R7414:Gmpr2 UTSW 14 55672802 critical splice donor site probably null
R7623:Gmpr2 UTSW 14 55673034 missense probably damaging 0.99
X0025:Gmpr2 UTSW 14 55675390 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAGGGAGACTTGAAGAACC -3'
(R):5'- CATCTGCTTTGAGTTCCGGAAC -3'

Sequencing Primer
(F):5'- TTGAAGAACCACACCCTGATCTG -3'
(R):5'- GTGAGCTCTACCTGCAGACATTAAG -3'
Posted On2015-01-23