Incidental Mutation 'R2904:Zfp160'
ID261598
Institutional Source Beutler Lab
Gene Symbol Zfp160
Ensembl Gene ENSMUSG00000067942
Gene Namezinc finger protein 160
Synonyms6720480D16Rik, 6720480D16Rik
MMRRC Submission 040491-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2904 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location21008903-21043070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 21025649 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 154 (V154I)
Ref Sequence ENSEMBL: ENSMUSP00000155977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088811] [ENSMUST00000231482] [ENSMUST00000232320] [ENSMUST00000232354] [ENSMUST00000232473] [ENSMUST00000232595] [ENSMUST00000232663]
Predicted Effect probably benign
Transcript: ENSMUST00000088811
AA Change: V154I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000086191
Gene: ENSMUSG00000067942
AA Change: V154I

DomainStartEndE-ValueType
KRAB 8 68 1.91e-29 SMART
low complexity region 100 110 N/A INTRINSIC
ZnF_C2H2 146 168 1.69e-3 SMART
ZnF_C2H2 174 196 2.91e-2 SMART
ZnF_C2H2 202 224 1.4e-4 SMART
ZnF_C2H2 230 252 3.89e-3 SMART
ZnF_C2H2 258 280 1.72e-4 SMART
ZnF_C2H2 286 308 4.94e-5 SMART
ZnF_C2H2 314 336 2.12e-4 SMART
ZnF_C2H2 342 364 1.12e-3 SMART
ZnF_C2H2 370 392 1.2e-3 SMART
ZnF_C2H2 398 420 6.42e-4 SMART
ZnF_C2H2 426 448 9.08e-4 SMART
ZnF_C2H2 454 476 1.84e-4 SMART
ZnF_C2H2 482 504 1.5e-4 SMART
ZnF_C2H2 510 532 3.44e-4 SMART
ZnF_C2H2 538 560 1.12e-3 SMART
ZnF_C2H2 566 588 2.27e-4 SMART
ZnF_C2H2 594 616 1.04e-3 SMART
ZnF_C2H2 622 644 1.13e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231482
Predicted Effect probably benign
Transcript: ENSMUST00000232320
Predicted Effect probably benign
Transcript: ENSMUST00000232354
AA Change: V154I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000232473
Predicted Effect probably benign
Transcript: ENSMUST00000232595
Predicted Effect probably benign
Transcript: ENSMUST00000232663
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 T C 5: 100,809,807 E182G probably benign Het
Acot4 C G 12: 84,043,603 T358S probably benign Het
Ap2a2 A G 7: 141,619,478 K433E probably damaging Het
Card11 T A 5: 140,889,133 D592V probably benign Het
Col12a1 G T 9: 79,652,025 S1860R probably damaging Het
Crisp1 C T 17: 40,313,004 probably null Het
Dzip1l A G 9: 99,663,669 E657G probably damaging Het
Fam208b T C 13: 3,582,185 N772S possibly damaging Het
Gak T C 5: 108,624,214 N79S possibly damaging Het
Gm9791 T C 3: 34,005,187 noncoding transcript Het
Gmpr2 T C 14: 55,672,758 V15A probably damaging Het
Hectd4 T C 5: 121,292,724 probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kdm4b G A 17: 56,355,884 G152S probably benign Het
Kdm6b G A 11: 69,405,785 T552I possibly damaging Het
Kdr T C 5: 75,966,409 Y307C probably damaging Het
Kif11 T C 19: 37,403,655 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Madd C T 2: 91,175,672 V20M probably damaging Het
Mkrn3 C A 7: 62,418,459 R528L probably benign Het
Myom2 T C 8: 15,098,348 V508A probably benign Het
Nav1 T C 1: 135,585,238 D28G probably benign Het
Nlrp4b T A 7: 10,714,367 W166R probably damaging Het
Olfr113 A T 17: 37,574,814 L203Q possibly damaging Het
Olfr483 T C 7: 108,103,599 Y97H probably benign Het
Rassf10 A T 7: 112,954,549 D119V possibly damaging Het
Smarcc1 A G 9: 110,173,975 N378D possibly damaging Het
Tas2r118 A G 6: 23,969,802 F87L possibly damaging Het
Trim21 A G 7: 102,559,971 W282R probably benign Het
Ttc26 T C 6: 38,401,102 V283A possibly damaging Het
Uggt2 T A 14: 119,059,109 Y447F possibly damaging Het
Other mutations in Zfp160
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Zfp160 APN 17 21026702 missense probably benign
IGL01019:Zfp160 APN 17 21020826 missense possibly damaging 0.68
IGL02430:Zfp160 APN 17 21025530 missense possibly damaging 0.76
R0412:Zfp160 UTSW 17 21026877 missense probably damaging 0.97
R0600:Zfp160 UTSW 17 21027006 missense probably benign 0.00
R2146:Zfp160 UTSW 17 21026982 missense probably benign 0.13
R2157:Zfp160 UTSW 17 21020828 missense probably benign 0.23
R2411:Zfp160 UTSW 17 21025745 missense possibly damaging 0.94
R4249:Zfp160 UTSW 17 21025738 missense probably benign 0.11
R4896:Zfp160 UTSW 17 21020081 missense probably benign 0.00
R5106:Zfp160 UTSW 17 21026761 missense probably damaging 0.99
R5342:Zfp160 UTSW 17 21020733 missense possibly damaging 0.95
R5352:Zfp160 UTSW 17 21026852 missense probably benign 0.02
R6193:Zfp160 UTSW 17 21026862 missense probably benign 0.24
R6230:Zfp160 UTSW 17 21026445 missense probably benign 0.38
R6753:Zfp160 UTSW 17 21020734 missense probably benign 0.02
R6928:Zfp160 UTSW 17 21041462 missense probably benign 0.04
R7040:Zfp160 UTSW 17 21026532 missense probably damaging 1.00
R7255:Zfp160 UTSW 17 21025487 missense probably benign 0.18
R7497:Zfp160 UTSW 17 21026193 missense probably benign 0.08
R7510:Zfp160 UTSW 17 21026393 missense probably benign 0.00
R7540:Zfp160 UTSW 17 21025660 nonsense probably null
R7627:Zfp160 UTSW 17 21027008 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAATGAAGCTAAGTCCATCAGCAG -3'
(R):5'- GTTTCTCACCAGTATGGATTCTTCG -3'

Sequencing Primer
(F):5'- AAGTCCATCAGCAGTGGTTC -3'
(R):5'- GGTGTGAATTCTGACTGAACACC -3'
Posted On2015-01-23