Incidental Mutation 'R2905:2310035C23Rik'
ID261604
Institutional Source Beutler Lab
Gene Symbol 2310035C23Rik
Ensembl Gene ENSMUSG00000026319
Gene NameRIKEN cDNA 2310035C23 gene
Synonyms
MMRRC Submission 040492-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.393) question?
Stock #R2905 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location105663861-105755191 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105691994 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 316 (V316A)
Ref Sequence ENSEMBL: ENSMUSP00000140699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039173] [ENSMUST00000086721] [ENSMUST00000186807] [ENSMUST00000190501]
Predicted Effect probably benign
Transcript: ENSMUST00000039173
AA Change: V316A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000039178
Gene: ENSMUSG00000026319
AA Change: V316A

DomainStartEndE-ValueType
low complexity region 7 14 N/A INTRINSIC
low complexity region 20 28 N/A INTRINSIC
low complexity region 35 47 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
low complexity region 107 119 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
LisH 231 263 1.25e-3 SMART
coiled coil region 334 372 N/A INTRINSIC
SCOP:d1b3ua_ 532 1069 4e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086721
AA Change: V316A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000083926
Gene: ENSMUSG00000026319
AA Change: V316A

DomainStartEndE-ValueType
low complexity region 7 14 N/A INTRINSIC
low complexity region 20 28 N/A INTRINSIC
low complexity region 35 47 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
low complexity region 107 119 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
coiled coil region 197 232 N/A INTRINSIC
LisH 255 287 1.25e-3 SMART
coiled coil region 358 396 N/A INTRINSIC
SCOP:d1b3ua_ 556 1093 5e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185692
Predicted Effect probably benign
Transcript: ENSMUST00000186807
AA Change: V316A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000140699
Gene: ENSMUSG00000026319
AA Change: V316A

DomainStartEndE-ValueType
low complexity region 7 14 N/A INTRINSIC
low complexity region 20 28 N/A INTRINSIC
low complexity region 35 47 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
low complexity region 107 119 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
coiled coil region 197 232 N/A INTRINSIC
LisH 255 287 3.9e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189091
Predicted Effect probably benign
Transcript: ENSMUST00000190501
AA Change: V292A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141162
Gene: ENSMUSG00000026319
AA Change: V292A

DomainStartEndE-ValueType
low complexity region 7 14 N/A INTRINSIC
low complexity region 20 28 N/A INTRINSIC
low complexity region 35 47 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
low complexity region 107 119 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
LisH 231 263 1.25e-3 SMART
coiled coil region 334 372 N/A INTRINSIC
SCOP:d1b3ua_ 532 1069 4e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191293
Meta Mutation Damage Score 0.0613 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109I03Rik T A 15: 74,879,867 Y106F probably benign Het
Ajap1 C A 4: 153,432,827 R19L probably benign Het
Alk A C 17: 71,985,494 S496R probably benign Het
Arhgap15 T C 2: 44,063,786 F175L probably damaging Het
Col12a1 G T 9: 79,652,025 S1860R probably damaging Het
Cuedc2 C T 19: 46,332,649 V15I probably benign Het
Dennd3 T A 15: 73,557,646 L4Q probably damaging Het
Dusp8 T A 7: 142,083,389 K234* probably null Het
Dzip1l A G 9: 99,663,669 E657G probably damaging Het
F7 C T 8: 13,034,775 T267I probably benign Het
Gm9791 T C 3: 34,005,187 noncoding transcript Het
Hmcn1 A G 1: 150,749,035 S1040P probably damaging Het
Jtb C G 3: 90,232,492 P62R probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Ly75 A G 2: 60,334,554 V760A probably benign Het
Nudt4 T G 10: 95,563,709 K17Q probably benign Het
Olfr815 T C 10: 129,902,400 I103M possibly damaging Het
Pde4a A T 9: 21,201,349 T274S probably benign Het
Pou6f1 C T 15: 100,585,958 V220I probably benign Het
Rif1 T C 2: 52,098,504 S752P probably damaging Het
Ror2 A G 13: 53,131,995 I73T probably benign Het
Samhd1 A T 2: 157,123,415 F160Y possibly damaging Het
Tas2r118 A G 6: 23,969,802 F87L possibly damaging Het
Thop1 T C 10: 81,079,591 L295P probably damaging Het
Tlr12 A G 4: 128,616,009 M816T probably damaging Het
Trip12 T C 1: 84,754,343 N970S probably benign Het
Ttc26 T C 6: 38,401,102 V283A possibly damaging Het
Ttll8 A T 15: 88,914,477 M685K probably benign Het
Ushbp1 G A 8: 71,387,535 R491* probably null Het
Other mutations in 2310035C23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:2310035C23Rik APN 1 105696599 splice site probably benign
IGL02393:2310035C23Rik APN 1 105687368 missense probably damaging 1.00
IGL02655:2310035C23Rik APN 1 105678246 missense probably damaging 1.00
IGL02992:2310035C23Rik APN 1 105719464 missense possibly damaging 0.89
IGL03170:2310035C23Rik APN 1 105735955 missense probably damaging 0.99
IGL03050:2310035C23Rik UTSW 1 105726381 missense probably damaging 0.98
R0022:2310035C23Rik UTSW 1 105691902 splice site probably benign
R0399:2310035C23Rik UTSW 1 105750959 splice site probably benign
R1243:2310035C23Rik UTSW 1 105750364 missense probably damaging 1.00
R1563:2310035C23Rik UTSW 1 105719534 missense probably damaging 1.00
R1760:2310035C23Rik UTSW 1 105719444 splice site probably benign
R1894:2310035C23Rik UTSW 1 105664576 missense probably benign 0.12
R2036:2310035C23Rik UTSW 1 105743254 missense probably damaging 1.00
R2428:2310035C23Rik UTSW 1 105746126 missense possibly damaging 0.88
R3121:2310035C23Rik UTSW 1 105725799 missense probably benign 0.15
R3750:2310035C23Rik UTSW 1 105753577 missense probably damaging 1.00
R3886:2310035C23Rik UTSW 1 105692213 missense probably benign 0.14
R4284:2310035C23Rik UTSW 1 105721287 missense probably damaging 0.98
R4671:2310035C23Rik UTSW 1 105718859 missense probably benign 0.00
R4706:2310035C23Rik UTSW 1 105692279 missense probably benign 0.28
R4760:2310035C23Rik UTSW 1 105721305 missense probably benign 0.17
R4776:2310035C23Rik UTSW 1 105719535 nonsense probably null
R5031:2310035C23Rik UTSW 1 105664514 missense probably damaging 1.00
R5051:2310035C23Rik UTSW 1 105691986 missense possibly damaging 0.85
R5085:2310035C23Rik UTSW 1 105678180 missense probably damaging 0.99
R5104:2310035C23Rik UTSW 1 105731240 missense probably benign 0.45
R5187:2310035C23Rik UTSW 1 105718809 nonsense probably null
R5259:2310035C23Rik UTSW 1 105721376 missense probably benign 0.01
R5435:2310035C23Rik UTSW 1 105741250 intron probably benign
R5444:2310035C23Rik UTSW 1 105726384 missense possibly damaging 0.60
R5490:2310035C23Rik UTSW 1 105719501 missense probably damaging 0.99
R5513:2310035C23Rik UTSW 1 105750973 missense probably damaging 0.99
R5556:2310035C23Rik UTSW 1 105693167 missense probably benign
R5734:2310035C23Rik UTSW 1 105703883 intron probably benign
R5779:2310035C23Rik UTSW 1 105687347 missense probably damaging 1.00
R5822:2310035C23Rik UTSW 1 105718856 missense probably damaging 1.00
R5878:2310035C23Rik UTSW 1 105692960 missense probably benign
R6015:2310035C23Rik UTSW 1 105691958 missense probably damaging 1.00
R6051:2310035C23Rik UTSW 1 105721272 missense probably damaging 1.00
R6266:2310035C23Rik UTSW 1 105731282 critical splice donor site probably null
R6556:2310035C23Rik UTSW 1 105726440 missense probably damaging 1.00
R6571:2310035C23Rik UTSW 1 105692982 missense probably benign
R6612:2310035C23Rik UTSW 1 105692007 missense possibly damaging 0.72
R6852:2310035C23Rik UTSW 1 105753595 missense probably damaging 1.00
R7209:2310035C23Rik UTSW 1 105750357 missense probably damaging 1.00
R7284:2310035C23Rik UTSW 1 105734583 missense probably benign 0.01
R7292:2310035C23Rik UTSW 1 105721416 critical splice donor site probably null
R7534:2310035C23Rik UTSW 1 105741023 missense probably benign 0.01
R7740:2310035C23Rik UTSW 1 105731261 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATATACACTTTGGGCTTTGTTGTT -3'
(R):5'- GCAGAAACTCAAGATCTCACAGG -3'

Sequencing Primer
(F):5'- CAGGTCATCTAATTTGGCAGC -3'
(R):5'- TCAAGATCTCACAGGAACATTTTTAC -3'
Posted On2015-01-23