Mutagenetix > Incidental Mutations

Incidental Mutation 'R2905:2310035C23Rik'

261604

Institutional Source

Beutler Lab

Gene Symbol

2310035C23Rik

Ensembl Gene

ENSMUSG00000026319

Gene Name

RIKEN cDNA 2310035C23 gene

Synonyms

MMRRC Submission

040492-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.329) question?

Stock #

R2905 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105663861-105755191 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 105691994 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 316 (V316A)

Ref Sequence

ENSEMBL: ENSMUSP00000140699 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039173] [ENSMUST00000086721] [ENSMUST00000186807] [ENSMUST00000190501]

Predicted Effect

probably benign
Transcript: ENSMUST00000039173
AA Change: V316A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000039178
Gene: ENSMUSG00000026319
AA Change: V316A

Domain	Start	End	E-Value	Type
low complexity region	7	14	N/A	INTRINSIC
low complexity region	20	28	N/A	INTRINSIC
low complexity region	35	47	N/A	INTRINSIC
low complexity region	76	86	N/A	INTRINSIC
low complexity region	107	119	N/A	INTRINSIC
low complexity region	142	154	N/A	INTRINSIC
LisH	231	263	1.25e-3	SMART
coiled coil region	334	372	N/A	INTRINSIC
SCOP:d1b3ua_	532	1069	4e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000086721
AA Change: V316A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000083926
Gene: ENSMUSG00000026319
AA Change: V316A

Domain	Start	End	E-Value	Type
low complexity region	7	14	N/A	INTRINSIC
low complexity region	20	28	N/A	INTRINSIC
low complexity region	35	47	N/A	INTRINSIC
low complexity region	76	86	N/A	INTRINSIC
low complexity region	107	119	N/A	INTRINSIC
low complexity region	142	154	N/A	INTRINSIC
coiled coil region	197	232	N/A	INTRINSIC
LisH	255	287	1.25e-3	SMART
coiled coil region	358	396	N/A	INTRINSIC
SCOP:d1b3ua_	556	1093	5e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000185692

Predicted Effect

probably benign
Transcript: ENSMUST00000186807
AA Change: V316A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000140699
Gene: ENSMUSG00000026319
AA Change: V316A

Domain	Start	End	E-Value	Type
low complexity region	7	14	N/A	INTRINSIC
low complexity region	20	28	N/A	INTRINSIC
low complexity region	35	47	N/A	INTRINSIC
low complexity region	76	86	N/A	INTRINSIC
low complexity region	107	119	N/A	INTRINSIC
low complexity region	142	154	N/A	INTRINSIC
coiled coil region	197	232	N/A	INTRINSIC
LisH	255	287	3.9e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189091

Predicted Effect

probably benign
Transcript: ENSMUST00000190501
AA Change: V292A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000141162
Gene: ENSMUSG00000026319
AA Change: V292A

Domain	Start	End	E-Value	Type
low complexity region	7	14	N/A	INTRINSIC
low complexity region	20	28	N/A	INTRINSIC
low complexity region	35	47	N/A	INTRINSIC
low complexity region	76	86	N/A	INTRINSIC
low complexity region	107	119	N/A	INTRINSIC
low complexity region	142	154	N/A	INTRINSIC
LisH	231	263	1.25e-3	SMART
coiled coil region	334	372	N/A	INTRINSIC
SCOP:d1b3ua_	532	1069	4e-22	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191293

Meta Mutation Damage Score

0.0613

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

100% (32/32)

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010109I03Rik	T	A	15: 74,879,867	Y106F	probably benign	Het
Ajap1	C	A	4: 153,432,827	R19L	probably benign	Het
Alk	A	C	17: 71,985,494	S496R	probably benign	Het
Arhgap15	T	C	2: 44,063,786	F175L	probably damaging	Het
Col12a1	G	T	9: 79,652,025	S1860R	probably damaging	Het
Cuedc2	C	T	19: 46,332,649	V15I	probably benign	Het
Dennd3	T	A	15: 73,557,646	L4Q	probably damaging	Het
Dusp8	T	A	7: 142,083,389	K234*	probably null	Het
Dzip1l	A	G	9: 99,663,669	E657G	probably damaging	Het
F7	C	T	8: 13,034,775	T267I	probably benign	Het
Gm9791	T	C	3: 34,005,187		noncoding transcript	Het
Hmcn1	A	G	1: 150,749,035	S1040P	probably damaging	Het
Jtb	C	G	3: 90,232,492	P62R	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Ly75	A	G	2: 60,334,554	V760A	probably benign	Het
Nudt4	T	G	10: 95,563,709	K17Q	probably benign	Het
Olfr815	T	C	10: 129,902,400	I103M	possibly damaging	Het
Pde4a	A	T	9: 21,201,349	T274S	probably benign	Het
Pou6f1	C	T	15: 100,585,958	V220I	probably benign	Het
Rif1	T	C	2: 52,098,504	S752P	probably damaging	Het
Ror2	A	G	13: 53,131,995	I73T	probably benign	Het
Samhd1	A	T	2: 157,123,415	F160Y	possibly damaging	Het
Tas2r118	A	G	6: 23,969,802	F87L	possibly damaging	Het
Thop1	T	C	10: 81,079,591	L295P	probably damaging	Het
Tlr12	A	G	4: 128,616,009	M816T	probably damaging	Het
Trip12	T	C	1: 84,754,343	N970S	probably benign	Het
Ttc26	T	C	6: 38,401,102	V283A	possibly damaging	Het
Ttll8	A	T	15: 88,914,477	M685K	probably benign	Het
Ushbp1	G	A	8: 71,387,535	R491*	probably null	Het

Other mutations in 2310035C23Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:2310035C23Rik	APN	1	105696599	splice site	probably benign
IGL02393:2310035C23Rik	APN	1	105687368	missense	probably damaging	1.00
IGL02655:2310035C23Rik	APN	1	105678246	missense	probably damaging	1.00
IGL02992:2310035C23Rik	APN	1	105719464	missense	possibly damaging	0.89
IGL03170:2310035C23Rik	APN	1	105735955	missense	probably damaging	0.99
IGL03050:2310035C23Rik	UTSW	1	105726381	missense	probably damaging	0.98
R0022:2310035C23Rik	UTSW	1	105691902	splice site	probably benign
R0399:2310035C23Rik	UTSW	1	105750959	splice site	probably benign
R1243:2310035C23Rik	UTSW	1	105750364	missense	probably damaging	1.00
R1563:2310035C23Rik	UTSW	1	105719534	missense	probably damaging	1.00
R1760:2310035C23Rik	UTSW	1	105719444	splice site	probably benign
R1894:2310035C23Rik	UTSW	1	105664576	missense	probably benign	0.12
R2036:2310035C23Rik	UTSW	1	105743254	missense	probably damaging	1.00
R2428:2310035C23Rik	UTSW	1	105746126	missense	possibly damaging	0.88
R3121:2310035C23Rik	UTSW	1	105725799	missense	probably benign	0.15
R3750:2310035C23Rik	UTSW	1	105753577	missense	probably damaging	1.00
R3886:2310035C23Rik	UTSW	1	105692213	missense	probably benign	0.14
R4284:2310035C23Rik	UTSW	1	105721287	missense	probably damaging	0.98
R4671:2310035C23Rik	UTSW	1	105718859	missense	probably benign	0.00
R4706:2310035C23Rik	UTSW	1	105692279	missense	probably benign	0.28
R4760:2310035C23Rik	UTSW	1	105721305	missense	probably benign	0.17
R4776:2310035C23Rik	UTSW	1	105719535	nonsense	probably null
R5031:2310035C23Rik	UTSW	1	105664514	missense	probably damaging	1.00
R5051:2310035C23Rik	UTSW	1	105691986	missense	possibly damaging	0.85
R5085:2310035C23Rik	UTSW	1	105678180	missense	probably damaging	0.99
R5104:2310035C23Rik	UTSW	1	105731240	missense	probably benign	0.45
R5187:2310035C23Rik	UTSW	1	105718809	nonsense	probably null
R5259:2310035C23Rik	UTSW	1	105721376	missense	probably benign	0.01
R5435:2310035C23Rik	UTSW	1	105741250	intron	probably benign
R5444:2310035C23Rik	UTSW	1	105726384	missense	possibly damaging	0.60
R5490:2310035C23Rik	UTSW	1	105719501	missense	probably damaging	0.99
R5513:2310035C23Rik	UTSW	1	105750973	missense	probably damaging	0.99
R5556:2310035C23Rik	UTSW	1	105693167	missense	probably benign
R5734:2310035C23Rik	UTSW	1	105703883	intron	probably benign
R5779:2310035C23Rik	UTSW	1	105687347	missense	probably damaging	1.00
R5822:2310035C23Rik	UTSW	1	105718856	missense	probably damaging	1.00
R5878:2310035C23Rik	UTSW	1	105692960	missense	probably benign
R6015:2310035C23Rik	UTSW	1	105691958	missense	probably damaging	1.00
R6051:2310035C23Rik	UTSW	1	105721272	missense	probably damaging	1.00
R6266:2310035C23Rik	UTSW	1	105731282	critical splice donor site	probably null
R6556:2310035C23Rik	UTSW	1	105726440	missense	probably damaging	1.00
R6571:2310035C23Rik	UTSW	1	105692982	missense	probably benign
R6612:2310035C23Rik	UTSW	1	105692007	missense	possibly damaging	0.72
R6852:2310035C23Rik	UTSW	1	105753595	missense	probably damaging	1.00
R7209:2310035C23Rik	UTSW	1	105750357	missense	probably damaging	1.00
R7284:2310035C23Rik	UTSW	1	105734583	missense	probably benign	0.01
R7292:2310035C23Rik	UTSW	1	105721416	critical splice donor site	probably null
R7534:2310035C23Rik	UTSW	1	105741023	missense	probably benign	0.01
R7740:2310035C23Rik	UTSW	1	105731261	missense	probably damaging	1.00
R8036:2310035C23Rik	UTSW	1	105678177	missense	probably damaging	1.00
R8234:2310035C23Rik	UTSW	1	105753510	missense	possibly damaging	0.93
Z1176:2310035C23Rik	UTSW	1	105719615	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- AATATACACTTTGGGCTTTGTTGTT -3'
(R):5'- GCAGAAACTCAAGATCTCACAGG -3'

Sequencing Primer
(F):5'- CAGGTCATCTAATTTGGCAGC -3'
(R):5'- TCAAGATCTCACAGGAACATTTTTAC -3'

Posted On

2015-01-23