Incidental Mutation 'R2905:Arhgap15'
ID 261606
Institutional Source Beutler Lab
Gene Symbol Arhgap15
Ensembl Gene ENSMUSG00000049744
Gene Name Rho GTPase activating protein 15
Synonyms 5830480G12Rik
MMRRC Submission 040492-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.465) question?
Stock # R2905 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 43638836-44285965 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43953798 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 175 (F175L)
Ref Sequence ENSEMBL: ENSMUSP00000056461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055776] [ENSMUST00000112822] [ENSMUST00000112824]
AlphaFold Q811M1
Predicted Effect probably damaging
Transcript: ENSMUST00000055776
AA Change: F175L

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000056461
Gene: ENSMUSG00000049744
AA Change: F175L

DomainStartEndE-ValueType
PH 88 199 1.24e-9 SMART
RhoGAP 298 473 1.55e-63 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112822
SMART Domains Protein: ENSMUSP00000108441
Gene: ENSMUSG00000049744

DomainStartEndE-ValueType
Blast:PH 88 108 5e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000112824
AA Change: F175L

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108443
Gene: ENSMUSG00000049744
AA Change: F175L

DomainStartEndE-ValueType
PH 88 199 1.24e-9 SMART
RhoGAP 298 469 1.16e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139948
Meta Mutation Damage Score 0.2306 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: The protein encoded by this gene is a RAC GTPase-activating protein that is regulated through its PH domain and by recruitment to the membrane. The protein accelerates hydrolysis of guanosine triphosphate to guanosine diphosphate to repress Rac activity. Knock-out of Arhgap15 function demonstrates that this gene is required to regulate multiple functions in macrophages and neutrophils. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display reduced leukocyte numbers and abnormally shaped macrophage. Chemotactic responses of macrophage are normal while neutrophile chemoattraction and bacterial pagocytosis are increased. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ajap1 C A 4: 153,517,284 (GRCm39) R19L probably benign Het
Alk A C 17: 72,292,489 (GRCm39) S496R probably benign Het
Col12a1 G T 9: 79,559,307 (GRCm39) S1860R probably damaging Het
Cuedc2 C T 19: 46,321,088 (GRCm39) V15I probably benign Het
Dennd3 T A 15: 73,429,495 (GRCm39) L4Q probably damaging Het
Dusp8 T A 7: 141,637,126 (GRCm39) K234* probably null Het
Dzip1l A G 9: 99,545,722 (GRCm39) E657G probably damaging Het
F7 C T 8: 13,084,775 (GRCm39) T267I probably benign Het
Gm9791 T C 3: 34,059,336 (GRCm39) noncoding transcript Het
Hmcn1 A G 1: 150,624,786 (GRCm39) S1040P probably damaging Het
Ift56 T C 6: 38,378,037 (GRCm39) V283A possibly damaging Het
Jtb C G 3: 90,139,799 (GRCm39) P62R probably damaging Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Ly6m T A 15: 74,751,716 (GRCm39) Y106F probably benign Het
Ly75 A G 2: 60,164,898 (GRCm39) V760A probably benign Het
Nudt4 T G 10: 95,399,571 (GRCm39) K17Q probably benign Het
Or6c217 T C 10: 129,738,269 (GRCm39) I103M possibly damaging Het
Pde4a A T 9: 21,112,645 (GRCm39) T274S probably benign Het
Pou6f1 C T 15: 100,483,839 (GRCm39) V220I probably benign Het
Relch T C 1: 105,619,719 (GRCm39) V316A probably benign Het
Rif1 T C 2: 51,988,516 (GRCm39) S752P probably damaging Het
Ror2 A G 13: 53,286,031 (GRCm39) I73T probably benign Het
Samhd1 A T 2: 156,965,335 (GRCm39) F160Y possibly damaging Het
Tas2r118 A G 6: 23,969,801 (GRCm39) F87L possibly damaging Het
Thop1 T C 10: 80,915,425 (GRCm39) L295P probably damaging Het
Tlr12 A G 4: 128,509,802 (GRCm39) M816T probably damaging Het
Trip12 T C 1: 84,732,064 (GRCm39) N970S probably benign Het
Ttll8 A T 15: 88,798,680 (GRCm39) M685K probably benign Het
Ushbp1 G A 8: 71,840,179 (GRCm39) R491* probably null Het
Other mutations in Arhgap15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01533:Arhgap15 APN 2 44,133,165 (GRCm39) missense probably damaging 1.00
IGL01779:Arhgap15 APN 2 43,955,057 (GRCm39) missense possibly damaging 0.94
IGL02011:Arhgap15 APN 2 43,670,767 (GRCm39) missense probably damaging 1.00
IGL02506:Arhgap15 APN 2 43,953,820 (GRCm39) missense possibly damaging 0.73
IGL02659:Arhgap15 APN 2 43,953,849 (GRCm39) missense probably damaging 1.00
IGL02711:Arhgap15 APN 2 44,006,674 (GRCm39) missense possibly damaging 0.67
IGL02944:Arhgap15 APN 2 44,032,362 (GRCm39) critical splice donor site probably null
IGL02989:Arhgap15 APN 2 43,670,748 (GRCm39) missense probably damaging 1.00
PIT4468001:Arhgap15 UTSW 2 44,133,143 (GRCm39) missense probably damaging 1.00
R0140:Arhgap15 UTSW 2 44,212,779 (GRCm39) missense probably damaging 1.00
R0403:Arhgap15 UTSW 2 43,953,778 (GRCm39) missense probably damaging 0.98
R0557:Arhgap15 UTSW 2 44,006,629 (GRCm39) missense possibly damaging 0.60
R0616:Arhgap15 UTSW 2 44,006,729 (GRCm39) critical splice donor site probably null
R1122:Arhgap15 UTSW 2 44,032,307 (GRCm39) missense probably benign 0.43
R1958:Arhgap15 UTSW 2 44,133,136 (GRCm39) missense possibly damaging 0.67
R2258:Arhgap15 UTSW 2 44,276,359 (GRCm39) missense probably damaging 1.00
R4788:Arhgap15 UTSW 2 43,638,902 (GRCm39) start codon destroyed probably null 0.02
R4793:Arhgap15 UTSW 2 44,032,353 (GRCm39) missense probably damaging 1.00
R5040:Arhgap15 UTSW 2 43,734,825 (GRCm39) critical splice donor site probably null
R5093:Arhgap15 UTSW 2 44,212,767 (GRCm39) missense probably damaging 1.00
R5114:Arhgap15 UTSW 2 43,670,630 (GRCm39) missense probably benign 0.03
R5202:Arhgap15 UTSW 2 43,953,869 (GRCm39) missense probably benign 0.22
R5446:Arhgap15 UTSW 2 43,718,772 (GRCm39) missense probably benign 0.00
R5661:Arhgap15 UTSW 2 44,212,739 (GRCm39) missense possibly damaging 0.54
R6747:Arhgap15 UTSW 2 44,006,689 (GRCm39) missense probably damaging 1.00
R7392:Arhgap15 UTSW 2 43,953,786 (GRCm39) missense possibly damaging 0.61
R7502:Arhgap15 UTSW 2 43,670,630 (GRCm39) missense probably benign 0.03
R7630:Arhgap15 UTSW 2 43,670,648 (GRCm39) missense probably benign 0.01
R7658:Arhgap15 UTSW 2 44,032,280 (GRCm39) missense probably benign 0.18
R7735:Arhgap15 UTSW 2 44,006,642 (GRCm39) missense probably damaging 1.00
R8734:Arhgap15 UTSW 2 44,133,130 (GRCm39) missense probably damaging 1.00
R8743:Arhgap15 UTSW 2 43,638,876 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- AAATGTCAGCATTCTCCTTAGTTCC -3'
(R):5'- TACCTCACAAATCTTGACGGAAG -3'

Sequencing Primer
(F):5'- AGCATTCTCCTTAGTTCCCAGAAAG -3'
(R):5'- GCTAGTATCTCTCAGACATAGGATCC -3'
Posted On 2015-01-23