Incidental Mutation 'R2905:Dusp8'
ID261617
Institutional Source Beutler Lab
Gene Symbol Dusp8
Ensembl Gene ENSMUSG00000037887
Gene Namedual specificity phosphatase 8
Synonyms5530400B01Rik, Nttp1
MMRRC Submission 040492-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R2905 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location142079490-142095843 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 142083389 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 234 (K234*)
Ref Sequence ENSEMBL: ENSMUSP00000049414 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039926] [ENSMUST00000143661]
Predicted Effect probably null
Transcript: ENSMUST00000039926
AA Change: K234*
SMART Domains Protein: ENSMUSP00000049414
Gene: ENSMUSG00000037887
AA Change: K234*

DomainStartEndE-ValueType
RHOD 13 135 4.71e-14 SMART
DSPc 160 299 3.6e-69 SMART
low complexity region 334 353 N/A INTRINSIC
low complexity region 360 371 N/A INTRINSIC
low complexity region 405 422 N/A INTRINSIC
low complexity region 427 449 N/A INTRINSIC
low complexity region 452 470 N/A INTRINSIC
low complexity region 488 512 N/A INTRINSIC
low complexity region 546 600 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104221
Predicted Effect probably benign
Transcript: ENSMUST00000143661
SMART Domains Protein: ENSMUSP00000114307
Gene: ENSMUSG00000037887

DomainStartEndE-ValueType
RHOD 13 135 4.71e-14 SMART
Pfam:DSPc 168 231 1.5e-9 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which is associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates SAPK/JNK and p38, is expressed predominantly in the adult brain, heart, and skeletal muscle, is localized in the cytoplasm, and is induced by nerve growth factor and insulin. An intronless pseudogene for DUSP8 is present on chromosome 10q11.2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered myocardial fiber morphology, mildly increased cardiac muscle contractility at baseline, and decreased response of heart to induced stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109I03Rik T A 15: 74,879,867 Y106F probably benign Het
2310035C23Rik T C 1: 105,691,994 V316A probably benign Het
Ajap1 C A 4: 153,432,827 R19L probably benign Het
Alk A C 17: 71,985,494 S496R probably benign Het
Arhgap15 T C 2: 44,063,786 F175L probably damaging Het
Col12a1 G T 9: 79,652,025 S1860R probably damaging Het
Cuedc2 C T 19: 46,332,649 V15I probably benign Het
Dennd3 T A 15: 73,557,646 L4Q probably damaging Het
Dzip1l A G 9: 99,663,669 E657G probably damaging Het
F7 C T 8: 13,034,775 T267I probably benign Het
Gm9791 T C 3: 34,005,187 noncoding transcript Het
Hmcn1 A G 1: 150,749,035 S1040P probably damaging Het
Jtb C G 3: 90,232,492 P62R probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Ly75 A G 2: 60,334,554 V760A probably benign Het
Nudt4 T G 10: 95,563,709 K17Q probably benign Het
Olfr815 T C 10: 129,902,400 I103M possibly damaging Het
Pde4a A T 9: 21,201,349 T274S probably benign Het
Pou6f1 C T 15: 100,585,958 V220I probably benign Het
Rif1 T C 2: 52,098,504 S752P probably damaging Het
Ror2 A G 13: 53,131,995 I73T probably benign Het
Samhd1 A T 2: 157,123,415 F160Y possibly damaging Het
Tas2r118 A G 6: 23,969,802 F87L possibly damaging Het
Thop1 T C 10: 81,079,591 L295P probably damaging Het
Tlr12 A G 4: 128,616,009 M816T probably damaging Het
Trip12 T C 1: 84,754,343 N970S probably benign Het
Ttc26 T C 6: 38,401,102 V283A possibly damaging Het
Ttll8 A T 15: 88,914,477 M685K probably benign Het
Ushbp1 G A 8: 71,387,535 R491* probably null Het
Other mutations in Dusp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Dusp8 APN 7 142084423 missense probably benign 0.05
IGL02458:Dusp8 APN 7 142082747 missense probably benign 0.28
IGL02931:Dusp8 APN 7 142082930 missense probably benign 0.00
IGL03329:Dusp8 APN 7 142084360 nonsense probably null
R0009:Dusp8 UTSW 7 142082054 unclassified probably benign
R1054:Dusp8 UTSW 7 142082067 unclassified probably benign
R1611:Dusp8 UTSW 7 142082957 missense probably benign 0.04
R1883:Dusp8 UTSW 7 142084348 splice site probably null
R2119:Dusp8 UTSW 7 142082561 missense possibly damaging 0.91
R2326:Dusp8 UTSW 7 142090063 missense probably damaging 1.00
R2698:Dusp8 UTSW 7 142081964 unclassified probably benign
R3849:Dusp8 UTSW 7 142090065 missense probably damaging 1.00
R4921:Dusp8 UTSW 7 142082154 unclassified probably benign
R4942:Dusp8 UTSW 7 142082228 missense possibly damaging 0.85
R5288:Dusp8 UTSW 7 142089993 missense possibly damaging 0.95
R5385:Dusp8 UTSW 7 142089993 missense possibly damaging 0.95
R5386:Dusp8 UTSW 7 142089993 missense possibly damaging 0.95
R6301:Dusp8 UTSW 7 142083019 splice site probably null
R6520:Dusp8 UTSW 7 142083681 missense probably damaging 0.99
R6665:Dusp8 UTSW 7 142090105 missense probably damaging 0.97
RF016:Dusp8 UTSW 7 142082852 missense probably benign 0.04
X0064:Dusp8 UTSW 7 142082027 unclassified probably benign
Z1176:Dusp8 UTSW 7 142081943 missense unknown
Z1176:Dusp8 UTSW 7 142090077 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTCCCCAAGCTCTTGTCG -3'
(R):5'- CTCTATAGGGTGGAAGAGGCTG -3'

Sequencing Primer
(F):5'- AATTTGTACAATCCAAGTGGGTGG -3'
(R):5'- GCTGGCTAGAGGAAGACTAGAC -3'
Posted On2015-01-23