Incidental Mutation 'R2905:Dzip1l'
ID261624
Institutional Source Beutler Lab
Gene Symbol Dzip1l
Ensembl Gene ENSMUSG00000037784
Gene NameDAZ interacting protein 1-like
Synonyms
MMRRC Submission 040492-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R2905 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location99629496-99669256 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99663669 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 657 (E657G)
Ref Sequence ENSEMBL: ENSMUSP00000108507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078367] [ENSMUST00000112884] [ENSMUST00000112885] [ENSMUST00000112886]
Predicted Effect probably benign
Transcript: ENSMUST00000078367
AA Change: E658G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000077475
Gene: ENSMUSG00000037784
AA Change: E658G

DomainStartEndE-ValueType
Pfam:Dzip-like_N 24 144 5e-48 PFAM
low complexity region 153 159 N/A INTRINSIC
ZnF_C2H2 166 189 3.34e-2 SMART
low complexity region 221 238 N/A INTRINSIC
SCOP:d1eq1a_ 242 411 2e-3 SMART
low complexity region 422 441 N/A INTRINSIC
low complexity region 597 622 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112884
AA Change: E657G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108505
Gene: ENSMUSG00000037784
AA Change: E657G

DomainStartEndE-ValueType
Pfam:Dzip-like_N 24 144 9.8e-48 PFAM
low complexity region 153 159 N/A INTRINSIC
ZnF_C2H2 166 189 3.34e-2 SMART
low complexity region 221 238 N/A INTRINSIC
SCOP:d1eq1a_ 242 411 2e-3 SMART
low complexity region 422 441 N/A INTRINSIC
low complexity region 597 621 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112885
AA Change: E658G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000108506
Gene: ENSMUSG00000037784
AA Change: E658G

DomainStartEndE-ValueType
Pfam:Dzip-like_N 24 144 9.8e-48 PFAM
low complexity region 153 159 N/A INTRINSIC
ZnF_C2H2 166 189 3.34e-2 SMART
low complexity region 221 238 N/A INTRINSIC
SCOP:d1eq1a_ 242 411 2e-3 SMART
low complexity region 422 441 N/A INTRINSIC
low complexity region 597 622 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112886
AA Change: E657G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108507
Gene: ENSMUSG00000037784
AA Change: E657G

DomainStartEndE-ValueType
Pfam:Dzip-like_N 24 144 9.8e-48 PFAM
low complexity region 153 159 N/A INTRINSIC
ZnF_C2H2 166 189 3.34e-2 SMART
low complexity region 221 238 N/A INTRINSIC
SCOP:d1eq1a_ 242 411 2e-3 SMART
low complexity region 422 441 N/A INTRINSIC
low complexity region 597 621 N/A INTRINSIC
Meta Mutation Damage Score 0.0690 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109I03Rik T A 15: 74,879,867 Y106F probably benign Het
2310035C23Rik T C 1: 105,691,994 V316A probably benign Het
Ajap1 C A 4: 153,432,827 R19L probably benign Het
Alk A C 17: 71,985,494 S496R probably benign Het
Arhgap15 T C 2: 44,063,786 F175L probably damaging Het
Col12a1 G T 9: 79,652,025 S1860R probably damaging Het
Cuedc2 C T 19: 46,332,649 V15I probably benign Het
Dennd3 T A 15: 73,557,646 L4Q probably damaging Het
Dusp8 T A 7: 142,083,389 K234* probably null Het
F7 C T 8: 13,034,775 T267I probably benign Het
Gm9791 T C 3: 34,005,187 noncoding transcript Het
Hmcn1 A G 1: 150,749,035 S1040P probably damaging Het
Jtb C G 3: 90,232,492 P62R probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Ly75 A G 2: 60,334,554 V760A probably benign Het
Nudt4 T G 10: 95,563,709 K17Q probably benign Het
Olfr815 T C 10: 129,902,400 I103M possibly damaging Het
Pde4a A T 9: 21,201,349 T274S probably benign Het
Pou6f1 C T 15: 100,585,958 V220I probably benign Het
Rif1 T C 2: 52,098,504 S752P probably damaging Het
Ror2 A G 13: 53,131,995 I73T probably benign Het
Samhd1 A T 2: 157,123,415 F160Y possibly damaging Het
Tas2r118 A G 6: 23,969,802 F87L possibly damaging Het
Thop1 T C 10: 81,079,591 L295P probably damaging Het
Tlr12 A G 4: 128,616,009 M816T probably damaging Het
Trip12 T C 1: 84,754,343 N970S probably benign Het
Ttc26 T C 6: 38,401,102 V283A possibly damaging Het
Ttll8 A T 15: 88,914,477 M685K probably benign Het
Ushbp1 G A 8: 71,387,535 R491* probably null Het
Other mutations in Dzip1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dzip1l APN 9 99637777 missense probably damaging 0.99
IGL01992:Dzip1l APN 9 99663686 missense probably damaging 1.00
R0276:Dzip1l UTSW 9 99660998 missense probably benign 0.38
R0506:Dzip1l UTSW 9 99663081 missense possibly damaging 0.76
R1469:Dzip1l UTSW 9 99659776 critical splice donor site probably null
R1469:Dzip1l UTSW 9 99659776 critical splice donor site probably null
R2904:Dzip1l UTSW 9 99663669 missense probably damaging 0.99
R2911:Dzip1l UTSW 9 99655602 missense probably benign 0.00
R3106:Dzip1l UTSW 9 99642572 nonsense probably null
R3106:Dzip1l UTSW 9 99647121 missense probably benign 0.00
R4394:Dzip1l UTSW 9 99639854 missense probably damaging 1.00
R4570:Dzip1l UTSW 9 99647168 nonsense probably null
R4579:Dzip1l UTSW 9 99647214 missense probably damaging 1.00
R4695:Dzip1l UTSW 9 99647205 missense probably benign 0.11
R4696:Dzip1l UTSW 9 99663611 missense possibly damaging 0.94
R4748:Dzip1l UTSW 9 99642651 missense probably damaging 0.96
R5063:Dzip1l UTSW 9 99667652 missense probably damaging 1.00
R5747:Dzip1l UTSW 9 99639809 splice site probably null
R6089:Dzip1l UTSW 9 99642684 missense possibly damaging 0.63
R7030:Dzip1l UTSW 9 99665835 missense probably benign 0.00
R7454:Dzip1l UTSW 9 99659674 missense possibly damaging 0.59
R7485:Dzip1l UTSW 9 99661012 missense probably benign 0.02
R7706:Dzip1l UTSW 9 99637536 missense probably damaging 1.00
R7734:Dzip1l UTSW 9 99667682 missense probably damaging 1.00
R7790:Dzip1l UTSW 9 99660962 missense possibly damaging 0.58
Z1176:Dzip1l UTSW 9 99641761 missense possibly damaging 0.59
Z1177:Dzip1l UTSW 9 99665854 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TTTTGCCTGAGAGAGGAGCG -3'
(R):5'- CCAGTGACACATACATGGGG -3'

Sequencing Primer
(F):5'- GCAAAGTCTGGCTTTTGAGTATTTC -3'
(R):5'- CCAGTGACACATACATGGGGTAAAAG -3'
Posted On2015-01-23