Incidental Mutation 'R2906:Gm6430'
ID261638
Institutional Source Beutler Lab
Gene Symbol Gm6430
Ensembl Gene ENSMUSG00000044757
Gene Namepredicted gene 6430
Synonyms
MMRRC Submission 040493-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R2906 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location97024681-97025928 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 97024829 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000054664
SMART Domains Protein: ENSMUSP00000136398
Gene: ENSMUSG00000044757

DomainStartEndE-ValueType
RRM 12 86 3.26e-5 SMART
RRM 112 184 2.38e-7 SMART
low complexity region 233 254 N/A INTRINSIC
RRM 290 360 2.43e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188810
Meta Mutation Damage Score 0.2698 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 24,863,504 W690R probably damaging Het
Adgrg6 A G 10: 14,432,950 I800T probably benign Het
Afg3l2 G A 18: 67,440,222 T170M probably damaging Het
Ap1b1 T A 11: 5,031,641 N516K probably damaging Het
Armcx6 A T X: 134,749,450 C211S probably damaging Het
Atp7b G A 8: 22,011,554 T781I probably damaging Het
Cd96 T C 16: 46,051,487 T432A possibly damaging Het
Col13a1 T C 10: 61,860,488 probably benign Het
Ddx4 G T 13: 112,620,777 probably benign Het
Dnm1l A T 16: 16,314,311 S666T probably damaging Het
Duoxa1 C T 2: 122,304,674 V197M probably benign Het
Gtf2a1l G A 17: 88,694,655 R313H possibly damaging Het
Gucy2c A T 6: 136,708,387 V852E probably damaging Het
Kcnk1 G T 8: 125,995,799 V114L probably benign Het
Klra3 G T 6: 130,333,339 Q73K probably damaging Het
Lax1 A T 1: 133,688,905 M1K probably null Het
Lce1k T C 3: 92,806,575 S101G unknown Het
Med12l T C 3: 59,257,082 L1365P probably damaging Het
Mtx2 T C 2: 74,866,909 S83P probably damaging Het
Naip2 A C 13: 100,161,996 C511G probably damaging Het
Nefh A G 11: 4,940,216 I801T probably benign Het
Olfr938 A G 9: 39,078,373 V124A probably benign Het
Oxct2b A G 4: 123,117,030 I248V probably benign Het
Pcdhgb2 A T 18: 37,690,855 I300F probably damaging Het
Ptprc G A 1: 138,064,534 A1285V possibly damaging Het
Rassf3 A G 10: 121,414,392 L172P probably damaging Het
Rbm26 T A 14: 105,142,834 T516S probably benign Het
Rpusd1 T C 17: 25,730,731 S292P probably benign Het
Scamp5 A G 9: 57,443,863 V172A probably damaging Het
Snx25 T C 8: 46,049,523 probably null Het
Tmprss11g A G 5: 86,492,802 probably benign Het
Ttll3 G C 6: 113,392,510 probably benign Het
Uggt2 C T 14: 119,019,507 S1105N probably benign Het
Usp45 T A 4: 21,834,338 Y805* probably null Het
Zfp639 T C 3: 32,519,751 L175P probably damaging Het
Zfp995 T C 17: 21,880,266 D329G probably benign Het
Other mutations in Gm6430
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02610:Gm6430 APN 1 97024835 intron noncoding transcript
R2225:Gm6430 UTSW 1 97025716 unclassified noncoding transcript
R4258:Gm6430 UTSW 1 97024836 intron noncoding transcript
R4407:Gm6430 UTSW 1 97025572 unclassified noncoding transcript
Predicted Primers PCR Primer
(F):5'- TTGTGTGACATCAGCCCTGTC -3'
(R):5'- TTCCTTTGTGCATCCAAATGGG -3'

Sequencing Primer
(F):5'- AGCCCTGTCAAGTGTCCATGATG -3'
(R):5'- ATCATTGGCACTGTCGGC -3'
Posted On2015-01-23