Incidental Mutation 'R2906:Mtx2'
ID261641
Institutional Source Beutler Lab
Gene Symbol Mtx2
Ensembl Gene ENSMUSG00000027099
Gene Namemetaxin 2
Synonyms
MMRRC Submission 040493-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.865) question?
Stock #R2906 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location74825803-74878431 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74866909 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 83 (S83P)
Ref Sequence ENSEMBL: ENSMUSP00000028511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028511]
Predicted Effect probably damaging
Transcript: ENSMUST00000028511
AA Change: S83P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028511
Gene: ENSMUSG00000027099
AA Change: S83P

DomainStartEndE-ValueType
Pfam:GST_C_3 99 251 3.3e-21 PFAM
Pfam:GST_C_2 165 248 6.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155844
Meta Mutation Damage Score 0.176 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the metaxin 2 protein from mouse, which has been shown to interact with the mitochondrial membrane protein metaxin 1. Because of this similarity, it is thought that the encoded protein is peripherally associated with the cytosolic face of the outer mitochondrial membrane, and that it is involved in the import of proteins into the mitochondrion. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 7. [provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 24,863,504 W690R probably damaging Het
Adgrg6 A G 10: 14,432,950 I800T probably benign Het
Afg3l2 G A 18: 67,440,222 T170M probably damaging Het
Ap1b1 T A 11: 5,031,641 N516K probably damaging Het
Armcx6 A T X: 134,749,450 C211S probably damaging Het
Atp7b G A 8: 22,011,554 T781I probably damaging Het
Cd96 T C 16: 46,051,487 T432A possibly damaging Het
Col13a1 T C 10: 61,860,488 probably benign Het
Ddx4 G T 13: 112,620,777 probably benign Het
Dnm1l A T 16: 16,314,311 S666T probably damaging Het
Duoxa1 C T 2: 122,304,674 V197M probably benign Het
Gm6430 A T 1: 97,024,829 noncoding transcript Het
Gtf2a1l G A 17: 88,694,655 R313H possibly damaging Het
Gucy2c A T 6: 136,708,387 V852E probably damaging Het
Kcnk1 G T 8: 125,995,799 V114L probably benign Het
Klra3 G T 6: 130,333,339 Q73K probably damaging Het
Lax1 A T 1: 133,688,905 M1K probably null Het
Lce1k T C 3: 92,806,575 S101G unknown Het
Med12l T C 3: 59,257,082 L1365P probably damaging Het
Naip2 A C 13: 100,161,996 C511G probably damaging Het
Nefh A G 11: 4,940,216 I801T probably benign Het
Olfr938 A G 9: 39,078,373 V124A probably benign Het
Oxct2b A G 4: 123,117,030 I248V probably benign Het
Pcdhgb2 A T 18: 37,690,855 I300F probably damaging Het
Ptprc G A 1: 138,064,534 A1285V possibly damaging Het
Rassf3 A G 10: 121,414,392 L172P probably damaging Het
Rbm26 T A 14: 105,142,834 T516S probably benign Het
Rpusd1 T C 17: 25,730,731 S292P probably benign Het
Scamp5 A G 9: 57,443,863 V172A probably damaging Het
Snx25 T C 8: 46,049,523 probably null Het
Tmprss11g A G 5: 86,492,802 probably benign Het
Ttll3 G C 6: 113,392,510 probably benign Het
Uggt2 C T 14: 119,019,507 S1105N probably benign Het
Usp45 T A 4: 21,834,338 Y805* probably null Het
Zfp639 T C 3: 32,519,751 L175P probably damaging Het
Zfp995 T C 17: 21,880,266 D329G probably benign Het
Other mutations in Mtx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01867:Mtx2 APN 2 74876389 missense probably damaging 1.00
IGL03277:Mtx2 APN 2 74868404 missense probably damaging 1.00
R0593:Mtx2 UTSW 2 74869436 splice site probably benign
R0638:Mtx2 UTSW 2 74869290 splice site probably benign
R2240:Mtx2 UTSW 2 74869352 missense probably benign 0.00
R3151:Mtx2 UTSW 2 74847290 splice site probably null
R3732:Mtx2 UTSW 2 74847262 missense probably damaging 1.00
R3732:Mtx2 UTSW 2 74847262 missense probably damaging 1.00
R3733:Mtx2 UTSW 2 74847262 missense probably damaging 1.00
R6918:Mtx2 UTSW 2 74876353 missense probably damaging 1.00
R7154:Mtx2 UTSW 2 74876418 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAAGAGCTCTAGAAATGAATC -3'
(R):5'- CAGCCAACATCCTTGCTATTG -3'

Sequencing Primer
(F):5'- ACAGGCATGTGCTACTATGC -3'
(R):5'- CCAACATCCTTGCTATTGGTTTATAG -3'
Posted On2015-01-23