Incidental Mutation 'R2906:Zfp639'
ID261643
Institutional Source Beutler Lab
Gene Symbol Zfp639
Ensembl Gene ENSMUSG00000027667
Gene Namezinc finger protein 639
Synonyms6230400O18Rik
MMRRC Submission 040493-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.346) question?
Stock #R2906 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location32510259-32520833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32519751 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 175 (L175P)
Ref Sequence ENSEMBL: ENSMUSP00000141341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029203] [ENSMUST00000191783] [ENSMUST00000192985] [ENSMUST00000193119] [ENSMUST00000193287]
Predicted Effect probably damaging
Transcript: ENSMUST00000029203
AA Change: L175P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029203
Gene: ENSMUSG00000027667
AA Change: L175P

DomainStartEndE-ValueType
ZnF_C2H2 204 227 2.49e-1 SMART
ZnF_C2H2 233 255 8.09e-1 SMART
ZnF_C2H2 260 283 1.16e-1 SMART
ZnF_C2H2 289 311 2.14e0 SMART
ZnF_C2H2 317 340 3.47e0 SMART
ZnF_C2H2 374 397 3.29e-1 SMART
ZnF_C2H2 403 425 2.71e-2 SMART
ZnF_C2H2 431 454 2.86e-1 SMART
ZnF_C2H2 460 482 1.67e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191783
AA Change: L175P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141446
Gene: ENSMUSG00000027667
AA Change: L175P

DomainStartEndE-ValueType
ZnF_C2H2 204 227 2.49e-1 SMART
ZnF_C2H2 233 255 8.09e-1 SMART
ZnF_C2H2 260 283 1.16e-1 SMART
ZnF_C2H2 289 311 2.14e0 SMART
ZnF_C2H2 317 340 3.47e0 SMART
ZnF_C2H2 374 397 3.29e-1 SMART
ZnF_C2H2 403 425 2.71e-2 SMART
ZnF_C2H2 431 454 2.86e-1 SMART
ZnF_C2H2 460 482 1.67e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192985
Predicted Effect probably benign
Transcript: ENSMUST00000193119
Predicted Effect probably damaging
Transcript: ENSMUST00000193287
AA Change: L175P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141341
Gene: ENSMUSG00000027667
AA Change: L175P

DomainStartEndE-ValueType
ZnF_C2H2 204 227 2.49e-1 SMART
ZnF_C2H2 233 255 8.09e-1 SMART
ZnF_C2H2 260 283 1.16e-1 SMART
ZnF_C2H2 289 311 2.14e0 SMART
ZnF_C2H2 317 340 3.47e0 SMART
ZnF_C2H2 374 397 3.29e-1 SMART
ZnF_C2H2 403 425 2.71e-2 SMART
ZnF_C2H2 431 454 2.86e-1 SMART
ZnF_C2H2 460 482 1.67e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193290
Predicted Effect probably benign
Transcript: ENSMUST00000193789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194126
Meta Mutation Damage Score 0.0700 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Kruppel-like zinc finger family of proteins. Amplification and overexpression of this gene have been observed in esophageal squamous cell carcinoma. The encoded protein has been shown to bind DNA in a sequence-specific manner and may regulate HIV-1 gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 24,863,504 W690R probably damaging Het
Adgrg6 A G 10: 14,432,950 I800T probably benign Het
Afg3l2 G A 18: 67,440,222 T170M probably damaging Het
Ap1b1 T A 11: 5,031,641 N516K probably damaging Het
Armcx6 A T X: 134,749,450 C211S probably damaging Het
Atp7b G A 8: 22,011,554 T781I probably damaging Het
Cd96 T C 16: 46,051,487 T432A possibly damaging Het
Col13a1 T C 10: 61,860,488 probably benign Het
Ddx4 G T 13: 112,620,777 probably benign Het
Dnm1l A T 16: 16,314,311 S666T probably damaging Het
Duoxa1 C T 2: 122,304,674 V197M probably benign Het
Gm6430 A T 1: 97,024,829 noncoding transcript Het
Gtf2a1l G A 17: 88,694,655 R313H possibly damaging Het
Gucy2c A T 6: 136,708,387 V852E probably damaging Het
Kcnk1 G T 8: 125,995,799 V114L probably benign Het
Klra3 G T 6: 130,333,339 Q73K probably damaging Het
Lax1 A T 1: 133,688,905 M1K probably null Het
Lce1k T C 3: 92,806,575 S101G unknown Het
Med12l T C 3: 59,257,082 L1365P probably damaging Het
Mtx2 T C 2: 74,866,909 S83P probably damaging Het
Naip2 A C 13: 100,161,996 C511G probably damaging Het
Nefh A G 11: 4,940,216 I801T probably benign Het
Olfr938 A G 9: 39,078,373 V124A probably benign Het
Oxct2b A G 4: 123,117,030 I248V probably benign Het
Pcdhgb2 A T 18: 37,690,855 I300F probably damaging Het
Ptprc G A 1: 138,064,534 A1285V possibly damaging Het
Rassf3 A G 10: 121,414,392 L172P probably damaging Het
Rbm26 T A 14: 105,142,834 T516S probably benign Het
Rpusd1 T C 17: 25,730,731 S292P probably benign Het
Scamp5 A G 9: 57,443,863 V172A probably damaging Het
Snx25 T C 8: 46,049,523 probably null Het
Tmprss11g A G 5: 86,492,802 probably benign Het
Ttll3 G C 6: 113,392,510 probably benign Het
Uggt2 C T 14: 119,019,507 S1105N probably benign Het
Usp45 T A 4: 21,834,338 Y805* probably null Het
Zfp995 T C 17: 21,880,266 D329G probably benign Het
Other mutations in Zfp639
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Zfp639 APN 3 32519753 splice site probably null
IGL00571:Zfp639 APN 3 32519919 missense probably damaging 0.99
IGL00579:Zfp639 APN 3 32520477 missense probably damaging 0.98
IGL01952:Zfp639 APN 3 32515347 missense probably damaging 1.00
PIT4514001:Zfp639 UTSW 3 32520260 missense possibly damaging 0.46
R0412:Zfp639 UTSW 3 32517110 missense possibly damaging 0.92
R1195:Zfp639 UTSW 3 32519196 missense possibly damaging 0.92
R1195:Zfp639 UTSW 3 32519196 missense possibly damaging 0.92
R1195:Zfp639 UTSW 3 32519196 missense possibly damaging 0.92
R4660:Zfp639 UTSW 3 32520530 missense probably damaging 0.99
R5109:Zfp639 UTSW 3 32520436 splice site probably null
R6012:Zfp639 UTSW 3 32519122 missense probably damaging 1.00
R6321:Zfp639 UTSW 3 32517088 missense probably damaging 1.00
R6449:Zfp639 UTSW 3 32519661 missense possibly damaging 0.92
R7020:Zfp639 UTSW 3 32520112 missense probably damaging 0.98
R8034:Zfp639 UTSW 3 32520066 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGTGATGAAGAATGTGCCTCAC -3'
(R):5'- AGAAGCTTTCCTTACACACCCG -3'

Sequencing Primer
(F):5'- TGAAGAATGTGCCTCACCTGAGTC -3'
(R):5'- GACACACATTCGAGTCAGTGCG -3'
Posted On2015-01-23