Mutagenetix > Incidental Mutations

Incidental Mutation 'R2906:Ttll3'

261651

Institutional Source

Beutler Lab

Gene Symbol

Ttll3

Ensembl Gene

ENSMUSG00000030276

Gene Name

tubulin tyrosine ligase-like family, member 3

Synonyms

MMRRC Submission

040493-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2906 (G1)

Quality Score

196

Status

Validated

Chromosome

Chromosomal Location

113389260-113414587 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

G to C at 113392510 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000145044 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032414] [ENSMUST00000038889] [ENSMUST00000156898] [ENSMUST00000171058] [ENSMUST00000203578] [ENSMUST00000204026] [ENSMUST00000204802] [ENSMUST00000205017]

Predicted Effect

unknown
Transcript: ENSMUST00000032414
AA Change: S5T

SMART Domains

Protein: ENSMUSP00000032414
Gene: ENSMUSG00000030276
AA Change: S5T

Domain	Start	End	E-Value	Type
low complexity region	3	20	N/A	INTRINSIC
low complexity region	214	231	N/A	INTRINSIC
low complexity region	234	248	N/A	INTRINSIC
Pfam:TTL	404	698	7.7e-84	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000038889
AA Change: S5T

SMART Domains

Protein: ENSMUSP00000037870
Gene: ENSMUSG00000030276
AA Change: S5T

Domain	Start	End	E-Value	Type
low complexity region	3	20	N/A	INTRINSIC
low complexity region	214	231	N/A	INTRINSIC
low complexity region	234	248	N/A	INTRINSIC
Pfam:TTL	404	699	9e-85	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000156898

SMART Domains

Protein: ENSMUSP00000114839
Gene: ENSMUSG00000079426

Domain	Start	End	E-Value	Type
Pfam:ARPC4	1	167	8.3e-88	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171058

SMART Domains

Protein: ENSMUSP00000131690
Gene: ENSMUSG00000079426

Domain	Start	End	E-Value	Type
Pfam:ARPC4	1	91	1.1e-46	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000203524

Predicted Effect

probably benign
Transcript: ENSMUST00000203578

SMART Domains

Protein: ENSMUSP00000145344
Gene: ENSMUSG00000079426

Domain	Start	End	E-Value	Type
Pfam:ARPC4	1	77	1.2e-41	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000204026

SMART Domains

Protein: ENSMUSP00000145049
Gene: ENSMUSG00000030276

Domain	Start	End	E-Value	Type
low complexity region	66	83	N/A	INTRINSIC
low complexity region	86	100	N/A	INTRINSIC
low complexity region	248	259	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204683

Predicted Effect

probably benign
Transcript: ENSMUST00000204802

SMART Domains

Protein: ENSMUSP00000144751
Gene: ENSMUSG00000079426

Domain	Start	End	E-Value	Type
Pfam:ARPC4	1	77	1.2e-41	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000205017

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.2%

Validation Efficiency

97% (37/38)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduced number of primary cilia in colon epithelia accompanied by an increased rate of cell division which is compensated by faster tissue turnover in the colon. Mice exhibit increased incidence of colon tumors by chemical induction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam32	A	T	8: 24,863,504	W690R	probably damaging	Het
Adgrg6	A	G	10: 14,432,950	I800T	probably benign	Het
Afg3l2	G	A	18: 67,440,222	T170M	probably damaging	Het
Ap1b1	T	A	11: 5,031,641	N516K	probably damaging	Het
Armcx6	A	T	X: 134,749,450	C211S	probably damaging	Het
Atp7b	G	A	8: 22,011,554	T781I	probably damaging	Het
Cd96	T	C	16: 46,051,487	T432A	possibly damaging	Het
Col13a1	T	C	10: 61,860,488		probably benign	Het
Ddx4	G	T	13: 112,620,777		probably benign	Het
Dnm1l	A	T	16: 16,314,311	S666T	probably damaging	Het
Duoxa1	C	T	2: 122,304,674	V197M	probably benign	Het
Gm6430	A	T	1: 97,024,829		noncoding transcript	Het
Gtf2a1l	G	A	17: 88,694,655	R313H	possibly damaging	Het
Gucy2c	A	T	6: 136,708,387	V852E	probably damaging	Het
Kcnk1	G	T	8: 125,995,799	V114L	probably benign	Het
Klra3	G	T	6: 130,333,339	Q73K	probably damaging	Het
Lax1	A	T	1: 133,688,905	M1K	probably null	Het
Lce1k	T	C	3: 92,806,575	S101G	unknown	Het
Med12l	T	C	3: 59,257,082	L1365P	probably damaging	Het
Mtx2	T	C	2: 74,866,909	S83P	probably damaging	Het
Naip2	A	C	13: 100,161,996	C511G	probably damaging	Het
Nefh	A	G	11: 4,940,216	I801T	probably benign	Het
Olfr938	A	G	9: 39,078,373	V124A	probably benign	Het
Oxct2b	A	G	4: 123,117,030	I248V	probably benign	Het
Pcdhgb2	A	T	18: 37,690,855	I300F	probably damaging	Het
Ptprc	G	A	1: 138,064,534	A1285V	possibly damaging	Het
Rassf3	A	G	10: 121,414,392	L172P	probably damaging	Het
Rbm26	T	A	14: 105,142,834	T516S	probably benign	Het
Rpusd1	T	C	17: 25,730,731	S292P	probably benign	Het
Scamp5	A	G	9: 57,443,863	V172A	probably damaging	Het
Snx25	T	C	8: 46,049,523		probably null	Het
Tmprss11g	A	G	5: 86,492,802		probably benign	Het
Uggt2	C	T	14: 119,019,507	S1105N	probably benign	Het
Usp45	T	A	4: 21,834,338	Y805*	probably null	Het
Zfp639	T	C	3: 32,519,751	L175P	probably damaging	Het
Zfp995	T	C	17: 21,880,266	D329G	probably benign	Het

Other mutations in Ttll3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01338:Ttll3	APN	6	113394729	missense	probably damaging	1.00
IGL01677:Ttll3	APN	6	113412984	missense	probably benign
IGL01697:Ttll3	APN	6	113399729	missense	probably benign	0.00
IGL01944:Ttll3	APN	6	113414115	missense	probably benign
IGL02688:Ttll3	APN	6	113399739	missense	probably benign	0.00
IGL03068:Ttll3	APN	6	113409197	missense	probably damaging	1.00
R0373:Ttll3	UTSW	6	113398777	missense	probably damaging	1.00
R0472:Ttll3	UTSW	6	113409339	missense	probably damaging	1.00
R0625:Ttll3	UTSW	6	113408903	critical splice acceptor site	probably null
R1868:Ttll3	UTSW	6	113392764	missense	possibly damaging	0.95
R2026:Ttll3	UTSW	6	113398770	missense	probably damaging	1.00
R2061:Ttll3	UTSW	6	113409042	missense	possibly damaging	0.76
R2128:Ttll3	UTSW	6	113412934	missense	probably benign	0.31
R2896:Ttll3	UTSW	6	113392722	missense	probably benign	0.15
R2903:Ttll3	UTSW	6	113407323	missense	probably damaging	0.99
R4659:Ttll3	UTSW	6	113414141	missense	probably benign
R4746:Ttll3	UTSW	6	113407392	missense	probably damaging	1.00
R4984:Ttll3	UTSW	6	113412940	missense	probably benign	0.00
R5358:Ttll3	UTSW	6	113401331	missense	probably benign	0.26
R5372:Ttll3	UTSW	6	113401421	nonsense	probably null
R5525:Ttll3	UTSW	6	113412978	missense	probably benign
R5548:Ttll3	UTSW	6	113393117	missense	probably damaging	1.00
R5694:Ttll3	UTSW	6	113399708	missense	probably damaging	1.00
R5993:Ttll3	UTSW	6	113398031	nonsense	probably null
R6119:Ttll3	UTSW	6	113394741	missense	probably damaging	1.00
R6268:Ttll3	UTSW	6	113392563	missense	probably benign	0.00
R6719:Ttll3	UTSW	6	113399032	intron	probably benign
R6852:Ttll3	UTSW	6	113399155	frame shift	probably null
R6852:Ttll3	UTSW	6	113399157	frame shift	probably null
R6852:Ttll3	UTSW	6	113399159	frame shift	probably null
R6853:Ttll3	UTSW	6	113399157	frame shift	probably null
R6854:Ttll3	UTSW	6	113399157	frame shift	probably null
R7170:Ttll3	UTSW	6	113413878	missense	probably benign	0.41
R7239:Ttll3	UTSW	6	113399157	frame shift	probably null
R7302:Ttll3	UTSW	6	113409285	missense	probably damaging	1.00
R7330:Ttll3	UTSW	6	113399157	frame shift	probably null
R7330:Ttll3	UTSW	6	113399164	frame shift	probably null
R7586:Ttll3	UTSW	6	113399157	frame shift	probably null
R7586:Ttll3	UTSW	6	113399160	frame shift	probably null
R7586:Ttll3	UTSW	6	113399163	frame shift	probably null
R7587:Ttll3	UTSW	6	113399157	frame shift	probably null
R7701:Ttll3	UTSW	6	113399157	frame shift	probably null
R7702:Ttll3	UTSW	6	113399157	frame shift	probably null
R7774:Ttll3	UTSW	6	113399160	frame shift	probably null
R7775:Ttll3	UTSW	6	113399158	nonsense	probably null
R7775:Ttll3	UTSW	6	113399160	frame shift	probably null
R7776:Ttll3	UTSW	6	113399159	frame shift	probably null
R7793:Ttll3	UTSW	6	113399158	frame shift	probably null
R7793:Ttll3	UTSW	6	113399159	frame shift	probably null
R7797:Ttll3	UTSW	6	113394777	missense	possibly damaging	0.76
R7824:Ttll3	UTSW	6	113399157	frame shift	probably null
R7824:Ttll3	UTSW	6	113399161	frame shift	probably null
R7824:Ttll3	UTSW	6	113399164	frame shift	probably null
R7825:Ttll3	UTSW	6	113399157	frame shift	probably null
R7825:Ttll3	UTSW	6	113399159	frame shift	probably null
R7826:Ttll3	UTSW	6	113399157	frame shift	probably null
R7826:Ttll3	UTSW	6	113399159	frame shift	probably null
R7826:Ttll3	UTSW	6	113399160	frame shift	probably null
R7826:Ttll3	UTSW	6	113399161	frame shift	probably null
R7827:Ttll3	UTSW	6	113399157	frame shift	probably null
R7827:Ttll3	UTSW	6	113399162	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CTGGCAAATCAAGAGTATGTGG -3'
(R):5'- ATTGTAGCCTCTCAGACCGC -3'

Sequencing Primer
(F):5'- AAACCTTATTCGACTTCCCTAAGG -3'
(R):5'- TCTCAGACCGCCGGGAC -3'

Posted On

2015-01-23