Incidental Mutation 'R2906:Snx25'
ID261656
Institutional Source Beutler Lab
Gene Symbol Snx25
Ensembl Gene ENSMUSG00000038291
Gene Namesorting nexin 25
SynonymsLOC382008, SBBI31
MMRRC Submission 040493-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2906 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location46033261-46152159 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 46049523 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041582] [ENSMUST00000041582] [ENSMUST00000110378] [ENSMUST00000110378] [ENSMUST00000170416] [ENSMUST00000170416]
Predicted Effect probably null
Transcript: ENSMUST00000041582
SMART Domains Protein: ENSMUSP00000035785
Gene: ENSMUSG00000038291

DomainStartEndE-ValueType
Pfam:PXA 1 163 9e-32 PFAM
RGS 287 401 6.62e-10 SMART
low complexity region 421 438 N/A INTRINSIC
PX 512 624 1.38e-10 SMART
low complexity region 658 663 N/A INTRINSIC
low complexity region 664 676 N/A INTRINSIC
Pfam:Nexin_C 701 808 1.7e-35 PFAM
low complexity region 812 828 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000041582
SMART Domains Protein: ENSMUSP00000035785
Gene: ENSMUSG00000038291

DomainStartEndE-ValueType
Pfam:PXA 1 163 9e-32 PFAM
RGS 287 401 6.62e-10 SMART
low complexity region 421 438 N/A INTRINSIC
PX 512 624 1.38e-10 SMART
low complexity region 658 663 N/A INTRINSIC
low complexity region 664 676 N/A INTRINSIC
Pfam:Nexin_C 701 808 1.7e-35 PFAM
low complexity region 812 828 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110378
SMART Domains Protein: ENSMUSP00000106007
Gene: ENSMUSG00000038291

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
Pfam:PXA 145 306 8.7e-30 PFAM
RGS 433 547 6.62e-10 SMART
low complexity region 567 584 N/A INTRINSIC
PX 658 770 1.38e-10 SMART
low complexity region 804 809 N/A INTRINSIC
low complexity region 810 822 N/A INTRINSIC
Pfam:Nexin_C 847 953 1e-28 PFAM
low complexity region 958 974 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110378
SMART Domains Protein: ENSMUSP00000106007
Gene: ENSMUSG00000038291

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
Pfam:PXA 145 306 8.7e-30 PFAM
RGS 433 547 6.62e-10 SMART
low complexity region 567 584 N/A INTRINSIC
PX 658 770 1.38e-10 SMART
low complexity region 804 809 N/A INTRINSIC
low complexity region 810 822 N/A INTRINSIC
Pfam:Nexin_C 847 953 1e-28 PFAM
low complexity region 958 974 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136097
Predicted Effect probably null
Transcript: ENSMUST00000170416
SMART Domains Protein: ENSMUSP00000127640
Gene: ENSMUSG00000038291

DomainStartEndE-ValueType
Pfam:PXA 1 163 9e-32 PFAM
RGS 287 401 6.62e-10 SMART
low complexity region 421 438 N/A INTRINSIC
PX 512 624 1.38e-10 SMART
low complexity region 658 663 N/A INTRINSIC
low complexity region 664 676 N/A INTRINSIC
Pfam:Nexin_C 701 808 1.7e-35 PFAM
low complexity region 812 828 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170416
SMART Domains Protein: ENSMUSP00000127640
Gene: ENSMUSG00000038291

DomainStartEndE-ValueType
Pfam:PXA 1 163 9e-32 PFAM
RGS 287 401 6.62e-10 SMART
low complexity region 421 438 N/A INTRINSIC
PX 512 624 1.38e-10 SMART
low complexity region 658 663 N/A INTRINSIC
low complexity region 664 676 N/A INTRINSIC
Pfam:Nexin_C 701 808 1.7e-35 PFAM
low complexity region 812 828 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176410
Predicted Effect probably benign
Transcript: ENSMUST00000177186
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 24,863,504 W690R probably damaging Het
Adgrg6 A G 10: 14,432,950 I800T probably benign Het
Afg3l2 G A 18: 67,440,222 T170M probably damaging Het
Ap1b1 T A 11: 5,031,641 N516K probably damaging Het
Armcx6 A T X: 134,749,450 C211S probably damaging Het
Atp7b G A 8: 22,011,554 T781I probably damaging Het
Cd96 T C 16: 46,051,487 T432A possibly damaging Het
Col13a1 T C 10: 61,860,488 probably benign Het
Ddx4 G T 13: 112,620,777 probably benign Het
Dnm1l A T 16: 16,314,311 S666T probably damaging Het
Duoxa1 C T 2: 122,304,674 V197M probably benign Het
Gm6430 A T 1: 97,024,829 noncoding transcript Het
Gtf2a1l G A 17: 88,694,655 R313H possibly damaging Het
Gucy2c A T 6: 136,708,387 V852E probably damaging Het
Kcnk1 G T 8: 125,995,799 V114L probably benign Het
Klra3 G T 6: 130,333,339 Q73K probably damaging Het
Lax1 A T 1: 133,688,905 M1K probably null Het
Lce1k T C 3: 92,806,575 S101G unknown Het
Med12l T C 3: 59,257,082 L1365P probably damaging Het
Mtx2 T C 2: 74,866,909 S83P probably damaging Het
Naip2 A C 13: 100,161,996 C511G probably damaging Het
Nefh A G 11: 4,940,216 I801T probably benign Het
Olfr938 A G 9: 39,078,373 V124A probably benign Het
Oxct2b A G 4: 123,117,030 I248V probably benign Het
Pcdhgb2 A T 18: 37,690,855 I300F probably damaging Het
Ptprc G A 1: 138,064,534 A1285V possibly damaging Het
Rassf3 A G 10: 121,414,392 L172P probably damaging Het
Rbm26 T A 14: 105,142,834 T516S probably benign Het
Rpusd1 T C 17: 25,730,731 S292P probably benign Het
Scamp5 A G 9: 57,443,863 V172A probably damaging Het
Tmprss11g A G 5: 86,492,802 probably benign Het
Ttll3 G C 6: 113,392,510 probably benign Het
Uggt2 C T 14: 119,019,507 S1105N probably benign Het
Usp45 T A 4: 21,834,338 Y805* probably null Het
Zfp639 T C 3: 32,519,751 L175P probably damaging Het
Zfp995 T C 17: 21,880,266 D329G probably benign Het
Other mutations in Snx25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Snx25 APN 8 46038476 missense probably damaging 1.00
IGL01432:Snx25 APN 8 46105160 missense probably damaging 0.96
IGL01600:Snx25 APN 8 46116310 missense probably benign 0.00
IGL02150:Snx25 APN 8 46116281 missense possibly damaging 0.89
IGL02386:Snx25 APN 8 46041349 missense possibly damaging 0.93
IGL02691:Snx25 APN 8 46105265 missense possibly damaging 0.88
IGL03338:Snx25 APN 8 46045210 missense probably benign 0.04
IGL03377:Snx25 APN 8 46080301 unclassified probably benign
duo UTSW 8 46124082 start codon destroyed probably null 0.88
R0047:Snx25 UTSW 8 46041365 missense probably damaging 0.99
R0047:Snx25 UTSW 8 46041365 missense probably damaging 0.99
R0048:Snx25 UTSW 8 46105109 splice site probably benign
R0048:Snx25 UTSW 8 46105109 splice site probably benign
R0056:Snx25 UTSW 8 46038513 missense probably damaging 1.00
R0546:Snx25 UTSW 8 46103630 missense probably benign 0.00
R0791:Snx25 UTSW 8 46124082 start codon destroyed probably null 0.88
R1165:Snx25 UTSW 8 46035715 missense probably damaging 0.99
R1255:Snx25 UTSW 8 46116238 missense probably benign 0.13
R1262:Snx25 UTSW 8 46105291 missense probably damaging 0.98
R1522:Snx25 UTSW 8 46124082 start codon destroyed probably null 0.88
R1652:Snx25 UTSW 8 46049473 missense probably damaging 0.99
R1710:Snx25 UTSW 8 46116207 missense possibly damaging 0.69
R1829:Snx25 UTSW 8 46035632 missense possibly damaging 0.82
R2090:Snx25 UTSW 8 46056113 missense probably damaging 1.00
R2158:Snx25 UTSW 8 46041407 missense probably damaging 1.00
R4244:Snx25 UTSW 8 46105254 missense probably damaging 0.98
R4394:Snx25 UTSW 8 46035678 missense probably damaging 1.00
R4465:Snx25 UTSW 8 46068229 missense possibly damaging 0.78
R4586:Snx25 UTSW 8 46116437 intron probably benign
R4663:Snx25 UTSW 8 46035579 missense probably damaging 1.00
R4961:Snx25 UTSW 8 46068192 missense probably damaging 0.99
R5104:Snx25 UTSW 8 46068166 makesense probably null
R5634:Snx25 UTSW 8 46041391 missense possibly damaging 0.94
R6128:Snx25 UTSW 8 46105203 missense probably benign 0.01
R6344:Snx25 UTSW 8 46035638 nonsense probably null
R6382:Snx25 UTSW 8 46055991 missense probably benign
R6523:Snx25 UTSW 8 46055855 missense probably damaging 0.96
R6798:Snx25 UTSW 8 46033773 missense probably damaging 0.98
R7143:Snx25 UTSW 8 46035715 missense possibly damaging 0.92
R7147:Snx25 UTSW 8 46105196 missense probably damaging 0.98
R7519:Snx25 UTSW 8 46116272 missense probably damaging 1.00
R7723:Snx25 UTSW 8 46038479 missense probably damaging 1.00
RF002:Snx25 UTSW 8 46116181 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCAATGATACCTCTGCGC -3'
(R):5'- TTGTCCCTGGGCATTCTTAGTTAA -3'

Sequencing Primer
(F):5'- CAATGATACCTCTGCGCTGGTG -3'
(R):5'- TTCCAGGCCATGAACTTAGG -3'
Posted On2015-01-23