Incidental Mutation 'R2907:Psmd4'
ID261681
Institutional Source Beutler Lab
Gene Symbol Psmd4
Ensembl Gene ENSMUSG00000005625
Gene Nameproteasome (prosome, macropain) 26S subunit, non-ATPase, 4
SynonymsAf1, multiubiquitin-chain-binding protein, Mcb1, angiocidin
MMRRC Submission 040494-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2907 (G1)
Quality Score180
Status Validated
Chromosome3
Chromosomal Location95032694-95042614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 95033962 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 55 (A55E)
Ref Sequence ENSEMBL: ENSMUSP00000114545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071664] [ENSMUST00000107237] [ENSMUST00000117355] [ENSMUST00000140348]
Predicted Effect probably benign
Transcript: ENSMUST00000071664
AA Change: A240E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000071589
Gene: ENSMUSG00000005625
AA Change: A240E

DomainStartEndE-ValueType
VWA 2 188 7.38e-12 SMART
low complexity region 189 201 N/A INTRINSIC
UIM 211 230 2.04e0 SMART
UIM 285 304 1.49e-2 SMART
low complexity region 307 320 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107237
AA Change: A240E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000102857
Gene: ENSMUSG00000005625
AA Change: A240E

DomainStartEndE-ValueType
VWA 2 188 7.38e-12 SMART
low complexity region 189 201 N/A INTRINSIC
UIM 211 230 2.04e0 SMART
UIM 282 301 1.49e-2 SMART
low complexity region 304 317 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117355
AA Change: A240E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000113554
Gene: ENSMUSG00000005625
AA Change: A240E

DomainStartEndE-ValueType
VWA 2 188 7.38e-12 SMART
low complexity region 189 201 N/A INTRINSIC
UIM 211 230 2.04e0 SMART
UIM 285 304 1.49e-2 SMART
low complexity region 307 320 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140280
Predicted Effect probably damaging
Transcript: ENSMUST00000140348
AA Change: A55E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114545
Gene: ENSMUSG00000005625
AA Change: A55E

DomainStartEndE-ValueType
Pfam:UIM 34 42 2.4e-3 PFAM
UIM 100 119 1.49e-2 SMART
low complexity region 122 135 N/A INTRINSIC
low complexity region 182 194 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147960
Meta Mutation Damage Score 0.0710 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the non-ATPase subunits of the 19S regulator lid. Pseudogenes have been identified on chromosomes 10 and 21. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality and abnormal embryogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,567,297 E385G probably damaging Het
Adam32 A T 8: 24,863,504 W690R probably damaging Het
Ap1b1 T A 11: 5,031,641 N516K probably damaging Het
Arap3 G A 18: 37,990,527 P452L possibly damaging Het
Armcx6 A T X: 134,749,450 C211S probably damaging Het
Asns A G 6: 7,675,506 S499P probably benign Het
Aspn G T 13: 49,551,898 V79F probably damaging Het
Astn2 A G 4: 65,644,856 I844T possibly damaging Het
Asxl3 A T 18: 22,517,273 H773L possibly damaging Het
Atp7b G A 8: 22,011,554 T781I probably damaging Het
Bcl6 G A 16: 23,968,119 R641W probably damaging Het
Csmd3 T A 15: 48,011,053 I612F probably damaging Het
Dnm1l A T 16: 16,314,311 S666T probably damaging Het
Gucy2c A T 6: 136,708,387 V852E probably damaging Het
H2-T3 G A 17: 36,187,455 R233C possibly damaging Het
Igfbp4 A G 11: 99,041,551 probably benign Het
Igkv16-104 T C 6: 68,425,927 I68T probably damaging Het
Kansl1 T A 11: 104,424,460 S251C possibly damaging Het
Kcnk1 G T 8: 125,995,799 V114L probably benign Het
Klra3 G T 6: 130,333,339 Q73K probably damaging Het
Mcpt1 T C 14: 56,020,123 V242A probably damaging Het
Nek10 C A 14: 14,980,613 Q990K possibly damaging Het
Nlrp4d A T 7: 10,378,427 V605E probably benign Het
Olfr1176 T C 2: 88,340,483 I306T probably benign Het
Olfr1437 T C 19: 12,322,668 D53G probably damaging Het
Olfr1490 C T 19: 13,655,247 P268S possibly damaging Het
Osbpl1a A G 18: 12,871,072 probably benign Het
Otud4 T A 8: 79,673,068 S803T probably benign Het
Pax9 C T 12: 56,709,744 T289I probably benign Het
Pcdha5 A C 18: 36,960,815 I126L possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rbm26 T A 14: 105,142,834 T516S probably benign Het
Sdr42e1 G A 8: 117,662,772 L377F probably damaging Het
Setdb1 T C 3: 95,327,201 probably benign Het
Uba3 T C 6: 97,203,553 E21G probably benign Het
Uggt2 C T 14: 119,019,507 S1105N probably benign Het
Zfp113 T C 5: 138,144,957 N344D probably benign Het
Zfp738 T C 13: 67,670,112 I587V probably benign Het
Other mutations in Psmd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02396:Psmd4 APN 3 95035910 missense probably damaging 1.00
R0173:Psmd4 UTSW 3 95032923 missense probably damaging 1.00
R1962:Psmd4 UTSW 3 95036701 missense possibly damaging 0.89
R3781:Psmd4 UTSW 3 95036728 missense probably benign 0.09
R3783:Psmd4 UTSW 3 95035251 missense possibly damaging 0.85
R4902:Psmd4 UTSW 3 95035859 missense probably damaging 0.98
R5090:Psmd4 UTSW 3 95035248 missense possibly damaging 0.53
R8031:Psmd4 UTSW 3 95035892 missense not run
X0024:Psmd4 UTSW 3 95036717 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCTAGTAGATATTCCACAGGGC -3'
(R):5'- ATACCACAGCATCGACTGTG -3'

Sequencing Primer
(F):5'- TAGATATTCCACAGGGCTGGCC -3'
(R):5'- GGGCATCAGATCTCATTACAGATG -3'
Posted On2015-01-23