Incidental Mutation 'R2907:Setdb1'
ID261682
Institutional Source Beutler Lab
Gene Symbol Setdb1
Ensembl Gene ENSMUSG00000015697
Gene NameSET domain, bifurcated 1
SynonymsKMT1E, ESET
MMRRC Submission 040494-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2907 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location95323525-95357202 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 95327201 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015841] [ENSMUST00000015858] [ENSMUST00000107170] [ENSMUST00000107171]
Predicted Effect probably benign
Transcript: ENSMUST00000015841
SMART Domains Protein: ENSMUSP00000015841
Gene: ENSMUSG00000015697

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 121 131 N/A INTRINSIC
TUDOR 256 318 6.16e-8 SMART
TUDOR 346 401 1.03e-9 SMART
low complexity region 451 471 N/A INTRINSIC
low complexity region 496 516 N/A INTRINSIC
low complexity region 529 568 N/A INTRINSIC
MBD 615 690 4.63e-33 SMART
PreSET 697 804 1.75e-41 SMART
SET 821 1289 1.76e-41 SMART
PostSET 1292 1308 1.88e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000015858
SMART Domains Protein: ENSMUSP00000015858
Gene: ENSMUSG00000015714

DomainStartEndE-ValueType
transmembrane domain 46 68 N/A INTRINSIC
HOX 71 132 3.08e-2 SMART
TLC 131 332 1.17e-81 SMART
low complexity region 337 360 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107170
SMART Domains Protein: ENSMUSP00000102788
Gene: ENSMUSG00000015697

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 121 131 N/A INTRINSIC
TUDOR 256 318 6.16e-8 SMART
TUDOR 346 401 1.03e-9 SMART
low complexity region 451 471 N/A INTRINSIC
low complexity region 496 516 N/A INTRINSIC
low complexity region 529 568 N/A INTRINSIC
MBD 615 690 4.63e-33 SMART
PreSET 697 804 1.75e-41 SMART
SET 821 1289 1.76e-41 SMART
PostSET 1292 1308 1.88e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107171
SMART Domains Protein: ENSMUSP00000102789
Gene: ENSMUSG00000015697

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 121 131 N/A INTRINSIC
TUDOR 256 318 6.16e-8 SMART
TUDOR 346 401 1.03e-9 SMART
low complexity region 451 471 N/A INTRINSIC
low complexity region 495 515 N/A INTRINSIC
low complexity region 528 567 N/A INTRINSIC
MBD 614 689 4.63e-33 SMART
PreSET 696 803 1.75e-41 SMART
SET 820 1288 1.76e-41 SMART
PostSET 1291 1307 1.88e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134702
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a histone methyltransferase which regulates histone methylation, gene silencing, and transcriptional repression. This gene has been identified as a target for treatment in Huntington Disease, given that gene silencing and transcription dysfunction likely play a role in the disease pathogenesis. Alternatively spliced transcript variants of this gene have been described.[provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous inactivation of this locus results in peri-implantation lethality. Inner cell mass growth is impaired in null blastocysts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,567,297 E385G probably damaging Het
Adam32 A T 8: 24,863,504 W690R probably damaging Het
Ap1b1 T A 11: 5,031,641 N516K probably damaging Het
Arap3 G A 18: 37,990,527 P452L possibly damaging Het
Armcx6 A T X: 134,749,450 C211S probably damaging Het
Asns A G 6: 7,675,506 S499P probably benign Het
Aspn G T 13: 49,551,898 V79F probably damaging Het
Astn2 A G 4: 65,644,856 I844T possibly damaging Het
Asxl3 A T 18: 22,517,273 H773L possibly damaging Het
Atp7b G A 8: 22,011,554 T781I probably damaging Het
Bcl6 G A 16: 23,968,119 R641W probably damaging Het
Csmd3 T A 15: 48,011,053 I612F probably damaging Het
Dnm1l A T 16: 16,314,311 S666T probably damaging Het
Gucy2c A T 6: 136,708,387 V852E probably damaging Het
H2-T3 G A 17: 36,187,455 R233C possibly damaging Het
Igfbp4 A G 11: 99,041,551 probably benign Het
Igkv16-104 T C 6: 68,425,927 I68T probably damaging Het
Kansl1 T A 11: 104,424,460 S251C possibly damaging Het
Kcnk1 G T 8: 125,995,799 V114L probably benign Het
Klra3 G T 6: 130,333,339 Q73K probably damaging Het
Mcpt1 T C 14: 56,020,123 V242A probably damaging Het
Nek10 C A 14: 14,980,613 Q990K possibly damaging Het
Nlrp4d A T 7: 10,378,427 V605E probably benign Het
Olfr1176 T C 2: 88,340,483 I306T probably benign Het
Olfr1437 T C 19: 12,322,668 D53G probably damaging Het
Olfr1490 C T 19: 13,655,247 P268S possibly damaging Het
Osbpl1a A G 18: 12,871,072 probably benign Het
Otud4 T A 8: 79,673,068 S803T probably benign Het
Pax9 C T 12: 56,709,744 T289I probably benign Het
Pcdha5 A C 18: 36,960,815 I126L possibly damaging Het
Psmd4 G T 3: 95,033,962 A55E probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rbm26 T A 14: 105,142,834 T516S probably benign Het
Sdr42e1 G A 8: 117,662,772 L377F probably damaging Het
Uba3 T C 6: 97,203,553 E21G probably benign Het
Uggt2 C T 14: 119,019,507 S1105N probably benign Het
Zfp113 T C 5: 138,144,957 N344D probably benign Het
Zfp738 T C 13: 67,670,112 I587V probably benign Het
Other mutations in Setdb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Setdb1 APN 3 95338577 missense probably damaging 1.00
IGL00915:Setdb1 APN 3 95346788 missense probably damaging 1.00
IGL01339:Setdb1 APN 3 95338580 nonsense probably null
IGL01710:Setdb1 APN 3 95338853 missense probably damaging 1.00
IGL02795:Setdb1 APN 3 95327373 missense probably damaging 1.00
IGL02824:Setdb1 APN 3 95339904 splice site probably benign
IGL02838:Setdb1 APN 3 95337268 splice site probably null
IGL03014:Setdb1 UTSW 3 95341415 missense probably damaging 1.00
R0077:Setdb1 UTSW 3 95341451 missense probably damaging 1.00
R0344:Setdb1 UTSW 3 95326131 unclassified probably benign
R0367:Setdb1 UTSW 3 95349881 splice site probably benign
R0374:Setdb1 UTSW 3 95324853 unclassified probably benign
R0411:Setdb1 UTSW 3 95327686 missense probably damaging 1.00
R0501:Setdb1 UTSW 3 95338829 missense probably benign 0.00
R0521:Setdb1 UTSW 3 95338829 missense probably benign 0.00
R0616:Setdb1 UTSW 3 95341798 missense probably damaging 1.00
R0828:Setdb1 UTSW 3 95338860 missense probably damaging 1.00
R0990:Setdb1 UTSW 3 95340265 missense probably benign 0.00
R1263:Setdb1 UTSW 3 95327611 missense probably damaging 0.99
R1297:Setdb1 UTSW 3 95349876 splice site probably benign
R1497:Setdb1 UTSW 3 95327467 missense probably benign 0.44
R2885:Setdb1 UTSW 3 95340195 missense probably benign
R3236:Setdb1 UTSW 3 95338754 missense probably damaging 0.99
R3237:Setdb1 UTSW 3 95338754 missense probably damaging 0.99
R3972:Setdb1 UTSW 3 95341338 missense probably damaging 1.00
R4260:Setdb1 UTSW 3 95327497 missense probably damaging 0.96
R5284:Setdb1 UTSW 3 95327570 missense probably damaging 1.00
R5484:Setdb1 UTSW 3 95337258 missense probably damaging 1.00
R5955:Setdb1 UTSW 3 95338842 missense probably damaging 1.00
R6542:Setdb1 UTSW 3 95340307 missense probably damaging 1.00
R6610:Setdb1 UTSW 3 95328577 missense probably damaging 1.00
R6632:Setdb1 UTSW 3 95324149 missense probably damaging 1.00
R6785:Setdb1 UTSW 3 95326401 missense probably benign 0.09
R7176:Setdb1 UTSW 3 95337147 critical splice donor site probably null
R7250:Setdb1 UTSW 3 95354541 critical splice donor site probably null
R7259:Setdb1 UTSW 3 95339913 missense probably benign 0.08
R7282:Setdb1 UTSW 3 95338674 missense probably damaging 1.00
R7497:Setdb1 UTSW 3 95341828 missense probably damaging 1.00
R7553:Setdb1 UTSW 3 95346765 missense probably damaging 1.00
R7921:Setdb1 UTSW 3 95326399 missense possibly damaging 0.85
R8022:Setdb1 UTSW 3 95338599 missense probably damaging 1.00
R8022:Setdb1 UTSW 3 95347085 missense probably damaging 1.00
R8189:Setdb1 UTSW 3 95346711 missense probably damaging 1.00
R8558:Setdb1 UTSW 3 95354668 missense possibly damaging 0.88
Z1177:Setdb1 UTSW 3 95338530 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTTGAAAGGGGTAAGGCC -3'
(R):5'- TGCAATAGTGTCAGTGAAGGTG -3'

Sequencing Primer
(F):5'- GTAAGGCCCTGTGTTTCAATC -3'
(R):5'- AAGGTGGATTTGCTGACTCTGACAG -3'
Posted On2015-01-23