Incidental Mutation 'R2907:Astn2'
ID261683
Institutional Source Beutler Lab
Gene Symbol Astn2
Ensembl Gene ENSMUSG00000028373
Gene Nameastrotactin 2
Synonyms1d8, Astnl
MMRRC Submission 040494-MU
Accession Numbers

Genbank: NM_019514.3, NM_207109.2; Ensembl: ENSMUST00000068214,   ENSMUST00000084496

Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R2907 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location65380803-66404611 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65644856 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 844 (I844T)
Ref Sequence ENSEMBL: ENSMUSP00000081540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068214] [ENSMUST00000084496]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068214
AA Change: I896T

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000065786
Gene: ENSMUSG00000028373
AA Change: I896T

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 87 127 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
low complexity region 303 312 N/A INTRINSIC
low complexity region 342 361 N/A INTRINSIC
low complexity region 393 404 N/A INTRINSIC
low complexity region 432 437 N/A INTRINSIC
transmembrane domain 443 465 N/A INTRINSIC
EGF_like 526 563 2.92e1 SMART
Blast:EGF_like 667 708 2e-18 BLAST
EGF_like 715 764 4.03e1 SMART
MACPF 864 1048 2.88e-55 SMART
FN3 1079 1191 2.41e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000084496
AA Change: I844T

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081540
Gene: ENSMUSG00000028373
AA Change: I844T

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 87 127 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
low complexity region 303 312 N/A INTRINSIC
low complexity region 341 352 N/A INTRINSIC
low complexity region 380 385 N/A INTRINSIC
transmembrane domain 391 413 N/A INTRINSIC
EGF_like 474 511 2.92e1 SMART
Blast:EGF_like 615 656 2e-18 BLAST
EGF_like 663 712 4.03e1 SMART
MACPF 812 996 2.88e-55 SMART
FN3 1027 1139 2.41e0 SMART
Meta Mutation Damage Score 0.0701 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is expressed in the brain and may function in neuronal migration, based on functional studies of the related astrotactin 1 gene in human and mouse. A deletion at this locus has been associated with schizophrenia. Multiple transcript variants encoding different proteins have been found for this locus. [provided by RefSeq, May 2010]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,567,297 E385G probably damaging Het
Adam32 A T 8: 24,863,504 W690R probably damaging Het
Ap1b1 T A 11: 5,031,641 N516K probably damaging Het
Arap3 G A 18: 37,990,527 P452L possibly damaging Het
Armcx6 A T X: 134,749,450 C211S probably damaging Het
Asns A G 6: 7,675,506 S499P probably benign Het
Aspn G T 13: 49,551,898 V79F probably damaging Het
Asxl3 A T 18: 22,517,273 H773L possibly damaging Het
Atp7b G A 8: 22,011,554 T781I probably damaging Het
Bcl6 G A 16: 23,968,119 R641W probably damaging Het
Csmd3 T A 15: 48,011,053 I612F probably damaging Het
Dnm1l A T 16: 16,314,311 S666T probably damaging Het
Gucy2c A T 6: 136,708,387 V852E probably damaging Het
H2-T3 G A 17: 36,187,455 R233C possibly damaging Het
Igfbp4 A G 11: 99,041,551 probably benign Het
Igkv16-104 T C 6: 68,425,927 I68T probably damaging Het
Kansl1 T A 11: 104,424,460 S251C possibly damaging Het
Kcnk1 G T 8: 125,995,799 V114L probably benign Het
Klra3 G T 6: 130,333,339 Q73K probably damaging Het
Mcpt1 T C 14: 56,020,123 V242A probably damaging Het
Nek10 C A 14: 14,980,613 Q990K possibly damaging Het
Nlrp4d A T 7: 10,378,427 V605E probably benign Het
Olfr1176 T C 2: 88,340,483 I306T probably benign Het
Olfr1437 T C 19: 12,322,668 D53G probably damaging Het
Olfr1490 C T 19: 13,655,247 P268S possibly damaging Het
Osbpl1a A G 18: 12,871,072 probably benign Het
Otud4 T A 8: 79,673,068 S803T probably benign Het
Pax9 C T 12: 56,709,744 T289I probably benign Het
Pcdha5 A C 18: 36,960,815 I126L possibly damaging Het
Psmd4 G T 3: 95,033,962 A55E probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rbm26 T A 14: 105,142,834 T516S probably benign Het
Sdr42e1 G A 8: 117,662,772 L377F probably damaging Het
Setdb1 T C 3: 95,327,201 probably benign Het
Uba3 T C 6: 97,203,553 E21G probably benign Het
Uggt2 C T 14: 119,019,507 S1105N probably benign Het
Zfp113 T C 5: 138,144,957 N344D probably benign Het
Zfp738 T C 13: 67,670,112 I587V probably benign Het
Other mutations in Astn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Astn2 APN 4 66185187 missense unknown
IGL01657:Astn2 APN 4 65651949 missense probably damaging 0.99
IGL01747:Astn2 APN 4 65794618 missense probably benign 0.17
IGL02008:Astn2 APN 4 66059153 missense probably damaging 1.00
IGL02215:Astn2 APN 4 66266234 missense unknown
IGL02484:Astn2 APN 4 65992279 splice site probably benign
IGL02494:Astn2 APN 4 65992348 missense probably benign 0.23
IGL02792:Astn2 APN 4 65644821 missense probably benign 0.32
IGL03248:Astn2 APN 4 65746293 splice site probably benign
IGL03409:Astn2 APN 4 65435186 missense possibly damaging 0.46
B6584:Astn2 UTSW 4 65992387 missense probably damaging 0.99
R0015:Astn2 UTSW 4 66266382 critical splice acceptor site probably null
R0015:Astn2 UTSW 4 66266382 critical splice acceptor site probably null
R0092:Astn2 UTSW 4 66403982 missense unknown
R0245:Astn2 UTSW 4 65794558 missense probably damaging 0.99
R0528:Astn2 UTSW 4 65644882 splice site probably benign
R0586:Astn2 UTSW 4 66185142 missense unknown
R0652:Astn2 UTSW 4 65794558 missense probably damaging 0.99
R0880:Astn2 UTSW 4 65648330 missense probably damaging 0.99
R0931:Astn2 UTSW 4 65648293 missense probably damaging 0.99
R1353:Astn2 UTSW 4 66266335 missense unknown
R1700:Astn2 UTSW 4 65746354 nonsense probably null
R1934:Astn2 UTSW 4 65435189 missense probably damaging 0.99
R2017:Astn2 UTSW 4 65540941 missense probably damaging 0.99
R2101:Astn2 UTSW 4 65581686 nonsense probably null
R2158:Astn2 UTSW 4 66404254 missense unknown
R2923:Astn2 UTSW 4 65913773 missense probably damaging 1.00
R2938:Astn2 UTSW 4 65992313 missense possibly damaging 0.92
R3033:Astn2 UTSW 4 65644706 missense probably damaging 1.00
R3933:Astn2 UTSW 4 66403955 missense unknown
R4151:Astn2 UTSW 4 65729320 critical splice donor site probably null
R4230:Astn2 UTSW 4 65911682 missense probably damaging 0.99
R4497:Astn2 UTSW 4 66119063 intron probably benign
R4717:Astn2 UTSW 4 65644754 missense possibly damaging 0.86
R4844:Astn2 UTSW 4 65644730 missense possibly damaging 0.90
R4928:Astn2 UTSW 4 65729407 missense probably damaging 0.98
R5374:Astn2 UTSW 4 65397005 missense probably damaging 0.96
R5442:Astn2 UTSW 4 65581786 missense possibly damaging 0.86
R5694:Astn2 UTSW 4 65950138 missense probably damaging 1.00
R5756:Astn2 UTSW 4 66119188 intron probably benign
R5763:Astn2 UTSW 4 65729331 missense probably benign 0.14
R6089:Astn2 UTSW 4 65794573 missense probably damaging 0.96
R6990:Astn2 UTSW 4 65992303 missense possibly damaging 0.82
R7304:Astn2 UTSW 4 66185375 missense unknown
R7325:Astn2 UTSW 4 65542669 missense probably benign 0.33
R7356:Astn2 UTSW 4 66185266 missense unknown
R7414:Astn2 UTSW 4 65540956 missense possibly damaging 0.85
R7755:Astn2 UTSW 4 65794558 missense probably damaging 0.99
R7887:Astn2 UTSW 4 65644866 missense possibly damaging 0.51
R7970:Astn2 UTSW 4 65644866 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- AGCCAGGGAATTGCCAAAGC -3'
(R):5'- GGTAAGCCTAGAGATGACAGCC -3'

Sequencing Primer
(F):5'- CTCACAGATAGGAGAAATGGGCTCTG -3'
(R):5'- CTGCTGCTCCCATGATAAGAGTG -3'
Posted On2015-01-23