Incidental Mutation 'R2907:Actl6b'
ID261685
Institutional Source Beutler Lab
Gene Symbol Actl6b
Ensembl Gene ENSMUSG00000029712
Gene Nameactin-like 6B
SynonymsActl6, ArpNa, Baf53b
MMRRC Submission 040494-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.754) question?
Stock #R2907 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location137553517-137569582 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 137567297 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 385 (E385G)
Ref Sequence ENSEMBL: ENSMUSP00000119356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031725] [ENSMUST00000031729] [ENSMUST00000136088] [ENSMUST00000136565] [ENSMUST00000139395] [ENSMUST00000196471] [ENSMUST00000198601] [ENSMUST00000198783] [ENSMUST00000198866] [ENSMUST00000199054]
Predicted Effect probably benign
Transcript: ENSMUST00000031725
SMART Domains Protein: ENSMUSP00000031725
Gene: ENSMUSG00000029712

DomainStartEndE-ValueType
ACTIN 11 379 4.16e-116 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000031729
SMART Domains Protein: ENSMUSP00000031729
Gene: ENSMUSG00000029716

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 235 326 2.2e-12 PFAM
Pfam:Peptidase_M28 407 618 2.9e-16 PFAM
Pfam:TFR_dimer 664 788 5.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136088
SMART Domains Protein: ENSMUSP00000117138
Gene: ENSMUSG00000029712

DomainStartEndE-ValueType
Pfam:Actin 1 75 4.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136565
SMART Domains Protein: ENSMUSP00000117425
Gene: ENSMUSG00000029712

DomainStartEndE-ValueType
Pfam:Actin 1 116 1.3e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000139395
AA Change: E385G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119356
Gene: ENSMUSG00000029712
AA Change: E385G

DomainStartEndE-ValueType
ACTIN 11 426 5.96e-167 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196471
SMART Domains Protein: ENSMUSP00000142814
Gene: ENSMUSG00000029716

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 231 328 1.3e-12 PFAM
Pfam:Peptidase_M28 418 606 7.5e-15 PFAM
low complexity region 612 625 N/A INTRINSIC
Pfam:TFR_dimer 663 790 1.8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198601
Predicted Effect probably benign
Transcript: ENSMUST00000198783
SMART Domains Protein: ENSMUSP00000142502
Gene: ENSMUSG00000029716

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 231 328 1.3e-12 PFAM
Pfam:Peptidase_M28 418 606 7.5e-15 PFAM
low complexity region 612 625 N/A INTRINSIC
Pfam:TFR_dimer 663 790 1.8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198866
SMART Domains Protein: ENSMUSP00000142720
Gene: ENSMUSG00000029716

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 231 328 1.3e-12 PFAM
Pfam:Peptidase_M28 418 606 7.5e-15 PFAM
low complexity region 612 625 N/A INTRINSIC
Pfam:TFR_dimer 663 790 1.8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199054
SMART Domains Protein: ENSMUSP00000142478
Gene: ENSMUSG00000029716

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 231 328 1.3e-12 PFAM
Pfam:Peptidase_M28 418 606 7.5e-15 PFAM
low complexity region 612 625 N/A INTRINSIC
Pfam:TFR_dimer 663 790 1.8e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199957
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200190
Meta Mutation Damage Score 0.9030 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of actin-related proteins (ARPs) which share significant amino acid sequence identity to conventional actins. Both actins and ARPs have an actin fold, which is an ATP-binding cleft, as a common feature. The ARPs are involved in diverse cellular processes, including vesicular transport, spindle orientation, nuclear migration and chromatin remodeling. This gene encodes a subunit of the BAF (BRG1/brm-associated factor) complex in mammals, which is functionally related to SWI/SNF complex in S. cerevisiae and Drosophila; the latter is thought to facilitate transcriptional activation of specific genes by antagonizing chromatin-mediated transcriptional repression. This subunit may be involved in the regulation of genes by structural modulation of their chromatin, specifically in the brain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygotes for null mutations exhibit low survivor rate and most die within 2 days after birth and show hyperactivity due to reduced dendrite formation in neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 24,863,504 W690R probably damaging Het
Ap1b1 T A 11: 5,031,641 N516K probably damaging Het
Arap3 G A 18: 37,990,527 P452L possibly damaging Het
Armcx6 A T X: 134,749,450 C211S probably damaging Het
Asns A G 6: 7,675,506 S499P probably benign Het
Aspn G T 13: 49,551,898 V79F probably damaging Het
Astn2 A G 4: 65,644,856 I844T possibly damaging Het
Asxl3 A T 18: 22,517,273 H773L possibly damaging Het
Atp7b G A 8: 22,011,554 T781I probably damaging Het
Bcl6 G A 16: 23,968,119 R641W probably damaging Het
Csmd3 T A 15: 48,011,053 I612F probably damaging Het
Dnm1l A T 16: 16,314,311 S666T probably damaging Het
Gucy2c A T 6: 136,708,387 V852E probably damaging Het
H2-T3 G A 17: 36,187,455 R233C possibly damaging Het
Igfbp4 A G 11: 99,041,551 probably benign Het
Igkv16-104 T C 6: 68,425,927 I68T probably damaging Het
Kansl1 T A 11: 104,424,460 S251C possibly damaging Het
Kcnk1 G T 8: 125,995,799 V114L probably benign Het
Klra3 G T 6: 130,333,339 Q73K probably damaging Het
Mcpt1 T C 14: 56,020,123 V242A probably damaging Het
Nek10 C A 14: 14,980,613 Q990K possibly damaging Het
Nlrp4d A T 7: 10,378,427 V605E probably benign Het
Olfr1176 T C 2: 88,340,483 I306T probably benign Het
Olfr1437 T C 19: 12,322,668 D53G probably damaging Het
Olfr1490 C T 19: 13,655,247 P268S possibly damaging Het
Osbpl1a A G 18: 12,871,072 probably benign Het
Otud4 T A 8: 79,673,068 S803T probably benign Het
Pax9 C T 12: 56,709,744 T289I probably benign Het
Pcdha5 A C 18: 36,960,815 I126L possibly damaging Het
Psmd4 G T 3: 95,033,962 A55E probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rbm26 T A 14: 105,142,834 T516S probably benign Het
Sdr42e1 G A 8: 117,662,772 L377F probably damaging Het
Setdb1 T C 3: 95,327,201 probably benign Het
Uba3 T C 6: 97,203,553 E21G probably benign Het
Uggt2 C T 14: 119,019,507 S1105N probably benign Het
Zfp113 T C 5: 138,144,957 N344D probably benign Het
Zfp738 T C 13: 67,670,112 I587V probably benign Het
Other mutations in Actl6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Actl6b APN 5 137554637 missense probably damaging 0.99
IGL03271:Actl6b APN 5 137565984 missense probably damaging 1.00
R0128:Actl6b UTSW 5 137555065 missense probably benign
R0254:Actl6b UTSW 5 137554144 intron probably benign
R0571:Actl6b UTSW 5 137566784 unclassified probably benign
R1438:Actl6b UTSW 5 137554609 missense probably damaging 0.99
R1530:Actl6b UTSW 5 137569378 missense probably damaging 1.00
R1621:Actl6b UTSW 5 137565779 missense probably benign 0.18
R2008:Actl6b UTSW 5 137569330 missense probably damaging 1.00
R3826:Actl6b UTSW 5 137567273 missense probably damaging 0.99
R5326:Actl6b UTSW 5 137567051 missense probably damaging 1.00
R5763:Actl6b UTSW 5 137566801 missense possibly damaging 0.49
R5906:Actl6b UTSW 5 137567329 missense possibly damaging 0.95
R5972:Actl6b UTSW 5 137566556 missense possibly damaging 0.55
R6709:Actl6b UTSW 5 137554517 missense possibly damaging 0.91
R7134:Actl6b UTSW 5 137564500 missense probably damaging 0.96
R7249:Actl6b UTSW 5 137555085 missense probably damaging 0.99
X0065:Actl6b UTSW 5 137565737 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGAACCCCAAATGCCTCCTG -3'
(R):5'- GCATTCACTGGCTGCACTTG -3'

Sequencing Primer
(F):5'- GATTCCCCTAAACAGAAATGCTCGTG -3'
(R):5'- CAAGGCTAGGACCTTAGTTCAGTC -3'
Posted On2015-01-23