Incidental Mutation 'R2907:Zfp113'
ID261686
Institutional Source Beutler Lab
Gene Symbol Zfp113
Ensembl Gene ENSMUSG00000037007
Gene Namezinc finger protein 113
Synonyms
MMRRC Submission 040494-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R2907 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location138139702-138155744 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 138144957 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 344 (N344D)
Ref Sequence ENSEMBL: ENSMUSP00000127561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049393] [ENSMUST00000165640]
Predicted Effect probably benign
Transcript: ENSMUST00000049393
AA Change: N344D

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000041796
Gene: ENSMUSG00000037007
AA Change: N344D

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 37 47 N/A INTRINSIC
KRAB 52 113 9.55e-21 SMART
ZnF_C2H2 201 223 8.47e-4 SMART
ZnF_C2H2 229 251 1.6e-4 SMART
ZnF_C2H2 257 279 1.28e-3 SMART
ZnF_C2H2 285 307 2.12e-4 SMART
ZnF_C2H2 313 335 5.59e-4 SMART
ZnF_C2H2 341 363 5.59e-4 SMART
ZnF_C2H2 369 391 1.26e-2 SMART
ZnF_C2H2 397 419 1.06e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165640
AA Change: N344D

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000127561
Gene: ENSMUSG00000037007
AA Change: N344D

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 37 47 N/A INTRINSIC
KRAB 52 113 9.55e-21 SMART
ZnF_C2H2 201 223 8.47e-4 SMART
ZnF_C2H2 229 251 1.6e-4 SMART
ZnF_C2H2 257 279 1.28e-3 SMART
ZnF_C2H2 285 307 2.12e-4 SMART
ZnF_C2H2 313 335 5.59e-4 SMART
ZnF_C2H2 341 363 5.59e-4 SMART
ZnF_C2H2 369 391 1.26e-2 SMART
ZnF_C2H2 397 419 1.06e-4 SMART
Meta Mutation Damage Score 0.1242 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,567,297 E385G probably damaging Het
Adam32 A T 8: 24,863,504 W690R probably damaging Het
Ap1b1 T A 11: 5,031,641 N516K probably damaging Het
Arap3 G A 18: 37,990,527 P452L possibly damaging Het
Armcx6 A T X: 134,749,450 C211S probably damaging Het
Asns A G 6: 7,675,506 S499P probably benign Het
Aspn G T 13: 49,551,898 V79F probably damaging Het
Astn2 A G 4: 65,644,856 I844T possibly damaging Het
Asxl3 A T 18: 22,517,273 H773L possibly damaging Het
Atp7b G A 8: 22,011,554 T781I probably damaging Het
Bcl6 G A 16: 23,968,119 R641W probably damaging Het
Csmd3 T A 15: 48,011,053 I612F probably damaging Het
Dnm1l A T 16: 16,314,311 S666T probably damaging Het
Gucy2c A T 6: 136,708,387 V852E probably damaging Het
H2-T3 G A 17: 36,187,455 R233C possibly damaging Het
Igfbp4 A G 11: 99,041,551 probably benign Het
Igkv16-104 T C 6: 68,425,927 I68T probably damaging Het
Kansl1 T A 11: 104,424,460 S251C possibly damaging Het
Kcnk1 G T 8: 125,995,799 V114L probably benign Het
Klra3 G T 6: 130,333,339 Q73K probably damaging Het
Mcpt1 T C 14: 56,020,123 V242A probably damaging Het
Nek10 C A 14: 14,980,613 Q990K possibly damaging Het
Nlrp4d A T 7: 10,378,427 V605E probably benign Het
Olfr1176 T C 2: 88,340,483 I306T probably benign Het
Olfr1437 T C 19: 12,322,668 D53G probably damaging Het
Olfr1490 C T 19: 13,655,247 P268S possibly damaging Het
Osbpl1a A G 18: 12,871,072 probably benign Het
Otud4 T A 8: 79,673,068 S803T probably benign Het
Pax9 C T 12: 56,709,744 T289I probably benign Het
Pcdha5 A C 18: 36,960,815 I126L possibly damaging Het
Psmd4 G T 3: 95,033,962 A55E probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rbm26 T A 14: 105,142,834 T516S probably benign Het
Sdr42e1 G A 8: 117,662,772 L377F probably damaging Het
Setdb1 T C 3: 95,327,201 probably benign Het
Uba3 T C 6: 97,203,553 E21G probably benign Het
Uggt2 C T 14: 119,019,507 S1105N probably benign Het
Zfp738 T C 13: 67,670,112 I587V probably benign Het
Other mutations in Zfp113
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03033:Zfp113 APN 5 138151196 splice site probably benign
R0217:Zfp113 UTSW 5 138150691 missense probably benign 0.01
R0733:Zfp113 UTSW 5 138145583 missense probably benign 0.18
R0764:Zfp113 UTSW 5 138145244 missense probably damaging 1.00
R0898:Zfp113 UTSW 5 138144789 missense probably benign 0.01
R1591:Zfp113 UTSW 5 138151197 splice site probably benign
R1623:Zfp113 UTSW 5 138145668 missense probably benign 0.00
R4840:Zfp113 UTSW 5 138145425 missense probably damaging 1.00
R4950:Zfp113 UTSW 5 138145472 missense probably benign
R5216:Zfp113 UTSW 5 138150715 missense probably damaging 1.00
R6084:Zfp113 UTSW 5 138145668 missense probably benign 0.00
R6766:Zfp113 UTSW 5 138145346 nonsense probably null
X0020:Zfp113 UTSW 5 138144836 missense probably damaging 1.00
X0022:Zfp113 UTSW 5 138145619 missense possibly damaging 0.71
X0027:Zfp113 UTSW 5 138145713 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGTGGACGCAGGACATGAAG -3'
(R):5'- GCTTCACTGTGAATTCCAAACTTATTT -3'

Sequencing Primer
(F):5'- TGAATCCTCTGATGGCGAAC -3'
(R):5'- GTCAGAGCGCACATCTTATTCAG -3'
Posted On2015-01-23