Incidental Mutation 'R2907:Asns'
ID261687
Institutional Source Beutler Lab
Gene Symbol Asns
Ensembl Gene ENSMUSG00000029752
Gene Nameasparagine synthetase
Synonyms
MMRRC Submission 040494-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R2907 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location7675169-7693254 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7675506 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 499 (S499P)
Ref Sequence ENSEMBL: ENSMUSP00000111204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031766] [ENSMUST00000115542]
Predicted Effect probably benign
Transcript: ENSMUST00000031766
AA Change: S499P

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000031766
Gene: ENSMUSG00000029752
AA Change: S499P

DomainStartEndE-ValueType
Pfam:GATase_6 29 160 4.3e-21 PFAM
Pfam:GATase_7 47 166 9.1e-26 PFAM
Pfam:DUF3700 68 178 5.5e-6 PFAM
Pfam:GATase_2 91 161 3.3e-5 PFAM
Pfam:Asn_synthase 234 467 1.7e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115542
AA Change: S499P

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000111204
Gene: ENSMUSG00000029752
AA Change: S499P

DomainStartEndE-ValueType
Pfam:GATase_6 29 160 1.2e-19 PFAM
Pfam:GATase_7 47 166 4.8e-25 PFAM
Pfam:DUF3700 64 180 3.3e-6 PFAM
Pfam:Asn_synthase 234 390 2.4e-46 PFAM
Pfam:Asn_synthase 382 547 1.5e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140097
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the synthesis of asparagine. This gene complements a mutation in the temperature-sensitive hamster mutant ts11, which blocks progression through the G1 phase of the cell cycle at nonpermissive temperature. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a hypomophic allele exhibit structural brain abnormalities, including enlarged ventricles and reduced cortical thickness, and deficits in short- and long-term memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,567,297 E385G probably damaging Het
Adam32 A T 8: 24,863,504 W690R probably damaging Het
Ap1b1 T A 11: 5,031,641 N516K probably damaging Het
Arap3 G A 18: 37,990,527 P452L possibly damaging Het
Armcx6 A T X: 134,749,450 C211S probably damaging Het
Aspn G T 13: 49,551,898 V79F probably damaging Het
Astn2 A G 4: 65,644,856 I844T possibly damaging Het
Asxl3 A T 18: 22,517,273 H773L possibly damaging Het
Atp7b G A 8: 22,011,554 T781I probably damaging Het
Bcl6 G A 16: 23,968,119 R641W probably damaging Het
Csmd3 T A 15: 48,011,053 I612F probably damaging Het
Dnm1l A T 16: 16,314,311 S666T probably damaging Het
Gucy2c A T 6: 136,708,387 V852E probably damaging Het
H2-T3 G A 17: 36,187,455 R233C possibly damaging Het
Igfbp4 A G 11: 99,041,551 probably benign Het
Igkv16-104 T C 6: 68,425,927 I68T probably damaging Het
Kansl1 T A 11: 104,424,460 S251C possibly damaging Het
Kcnk1 G T 8: 125,995,799 V114L probably benign Het
Klra3 G T 6: 130,333,339 Q73K probably damaging Het
Mcpt1 T C 14: 56,020,123 V242A probably damaging Het
Nek10 C A 14: 14,980,613 Q990K possibly damaging Het
Nlrp4d A T 7: 10,378,427 V605E probably benign Het
Olfr1176 T C 2: 88,340,483 I306T probably benign Het
Olfr1437 T C 19: 12,322,668 D53G probably damaging Het
Olfr1490 C T 19: 13,655,247 P268S possibly damaging Het
Osbpl1a A G 18: 12,871,072 probably benign Het
Otud4 T A 8: 79,673,068 S803T probably benign Het
Pax9 C T 12: 56,709,744 T289I probably benign Het
Pcdha5 A C 18: 36,960,815 I126L possibly damaging Het
Psmd4 G T 3: 95,033,962 A55E probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rbm26 T A 14: 105,142,834 T516S probably benign Het
Sdr42e1 G A 8: 117,662,772 L377F probably damaging Het
Setdb1 T C 3: 95,327,201 probably benign Het
Uba3 T C 6: 97,203,553 E21G probably benign Het
Uggt2 C T 14: 119,019,507 S1105N probably benign Het
Zfp113 T C 5: 138,144,957 N344D probably benign Het
Zfp738 T C 13: 67,670,112 I587V probably benign Het
Other mutations in Asns
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Asns APN 6 7680179 missense probably damaging 1.00
IGL00656:Asns APN 6 7680215 unclassified probably benign
IGL01534:Asns APN 6 7675397 missense probably benign 0.03
IGL01996:Asns APN 6 7682378 missense possibly damaging 0.56
IGL02058:Asns APN 6 7685184 missense probably damaging 1.00
IGL02311:Asns APN 6 7676233 critical splice donor site probably null
IGL02367:Asns APN 6 7685411 splice site probably benign
IGL03263:Asns APN 6 7689404 missense probably benign 0.07
IGL03341:Asns APN 6 7682002 missense probably damaging 0.98
PIT4445001:Asns UTSW 6 7689277 missense probably damaging 1.00
R0034:Asns UTSW 6 7676299 missense probably damaging 1.00
R0034:Asns UTSW 6 7676299 missense probably damaging 1.00
R0050:Asns UTSW 6 7676019 missense probably benign 0.02
R0627:Asns UTSW 6 7675516 missense probably benign 0.05
R1075:Asns UTSW 6 7676076 nonsense probably null
R1591:Asns UTSW 6 7678007 missense probably damaging 0.97
R2047:Asns UTSW 6 7680093 missense probably damaging 0.99
R2232:Asns UTSW 6 7689316 missense possibly damaging 0.82
R3907:Asns UTSW 6 7682270 critical splice donor site probably null
R4373:Asns UTSW 6 7677978 missense probably damaging 0.98
R4438:Asns UTSW 6 7675320 missense probably benign 0.15
R4660:Asns UTSW 6 7678012 missense probably benign 0.05
R4784:Asns UTSW 6 7678029 missense probably benign 0.12
R5655:Asns UTSW 6 7685309 missense probably benign 0.31
R5752:Asns UTSW 6 7689365 missense probably damaging 1.00
R5863:Asns UTSW 6 7675443 nonsense probably null
R5864:Asns UTSW 6 7675443 nonsense probably null
R5953:Asns UTSW 6 7682285 missense probably benign 0.00
R6773:Asns UTSW 6 7676284 missense probably benign 0.01
R6789:Asns UTSW 6 7675344 missense probably benign
R7389:Asns UTSW 6 7689291 missense probably damaging 1.00
R7524:Asns UTSW 6 7677259 splice site probably null
R7783:Asns UTSW 6 7677978 missense probably damaging 1.00
R7949:Asns UTSW 6 7685328 missense probably damaging 0.97
R8722:Asns UTSW 6 7676085 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTTATAATGGGTCAGAGTGCG -3'
(R):5'- GAGTCAAACACTGAGCCTCTAAG -3'

Sequencing Primer
(F):5'- CGGGCAGAAGGGTCAGTAGC -3'
(R):5'- GCATGAGAGCTTTTAAAAAGTCACTG -3'
Posted On2015-01-23