Incidental Mutation 'R2907:Uba3'
ID 261688
Institutional Source Beutler Lab
Gene Symbol Uba3
Ensembl Gene ENSMUSG00000030061
Gene Name ubiquitin-like modifier activating enzyme 3
Synonyms A830034N06Rik, ubiquitin activating enzyme 3, Ube1c
MMRRC Submission 040494-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2907 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 97160631-97182608 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 97180514 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 21 (E21G)
Ref Sequence ENSEMBL: ENSMUSP00000130954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089287] [ENSMUST00000164744] [ENSMUST00000204056]
AlphaFold Q8C878
Predicted Effect probably benign
Transcript: ENSMUST00000089287
AA Change: E35G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000086701
Gene: ENSMUSG00000030061
AA Change: E35G

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:ThiF 53 369 2.6e-69 PFAM
E2_bind 374 462 1.02e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164744
AA Change: E21G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000130954
Gene: ENSMUSG00000030061
AA Change: E21G

DomainStartEndE-ValueType
Pfam:ThiF 54 199 1.5e-41 PFAM
Pfam:UBA_e1_thiolCys 202 248 8.7e-15 PFAM
Pfam:UBACT 255 321 9e-25 PFAM
E2_bind 360 448 1.02e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203215
Predicted Effect probably benign
Transcript: ENSMUST00000204056
SMART Domains Protein: ENSMUSP00000145309
Gene: ENSMUSG00000030061

DomainStartEndE-ValueType
low complexity region 5 56 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204391
Meta Mutation Damage Score 0.0631 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: The protein encoded by this gene is the catalytic subunit of the enzyme that activates NEDD8, a ubiquitin-like molecule that binds to its target proteins through an enzymatic reaction analagous to ubiquitylation. Embryonic mice deficient for this protein die prior to implantation and display apoptosis of the inner cell mass. Trophoblastic cells cannot enter S phase, demonstrating that this gene is required for cell cycle progression during embryogenesis. Two pseudogenes have been found for this gene. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mutants die at the peri-implantation stage. Mutants exhibit selective apoptosis of the inner cell mass but not of trophoblastic cells. Moreover, the trophoblastic cells fail to enter the S phase of the endoreduplication cycle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,565,559 (GRCm39) E385G probably damaging Het
Adam32 A T 8: 25,353,520 (GRCm39) W690R probably damaging Het
Ap1b1 T A 11: 4,981,641 (GRCm39) N516K probably damaging Het
Arap3 G A 18: 38,123,580 (GRCm39) P452L possibly damaging Het
Armcx6 A T X: 133,650,199 (GRCm39) C211S probably damaging Het
Asns A G 6: 7,675,506 (GRCm39) S499P probably benign Het
Aspn G T 13: 49,705,374 (GRCm39) V79F probably damaging Het
Astn2 A G 4: 65,563,093 (GRCm39) I844T possibly damaging Het
Asxl3 A T 18: 22,650,330 (GRCm39) H773L possibly damaging Het
Atp7b G A 8: 22,501,570 (GRCm39) T781I probably damaging Het
Bcl6 G A 16: 23,786,869 (GRCm39) R641W probably damaging Het
Csmd3 T A 15: 47,874,449 (GRCm39) I612F probably damaging Het
Dnm1l A T 16: 16,132,175 (GRCm39) S666T probably damaging Het
Gucy2c A T 6: 136,685,385 (GRCm39) V852E probably damaging Het
H2-T3 G A 17: 36,498,347 (GRCm39) R233C possibly damaging Het
Igfbp4 A G 11: 98,932,377 (GRCm39) probably benign Het
Igkv16-104 T C 6: 68,402,911 (GRCm39) I68T probably damaging Het
Kansl1 T A 11: 104,315,286 (GRCm39) S251C possibly damaging Het
Kcnk1 G T 8: 126,722,538 (GRCm39) V114L probably benign Het
Klra3 G T 6: 130,310,302 (GRCm39) Q73K probably damaging Het
Mcpt1 T C 14: 56,257,580 (GRCm39) V242A probably damaging Het
Nek10 C A 14: 14,980,613 (GRCm38) Q990K possibly damaging Het
Nlrp4d A T 7: 10,112,354 (GRCm39) V605E probably benign Het
Or10w1 C T 19: 13,632,611 (GRCm39) P268S possibly damaging Het
Or5an1b T C 19: 12,300,032 (GRCm39) D53G probably damaging Het
Or5d46 T C 2: 88,170,827 (GRCm39) I306T probably benign Het
Osbpl1a A G 18: 13,004,129 (GRCm39) probably benign Het
Otud4 T A 8: 80,399,697 (GRCm39) S803T probably benign Het
Pax9 C T 12: 56,756,529 (GRCm39) T289I probably benign Het
Pcdha5 A C 18: 37,093,868 (GRCm39) I126L possibly damaging Het
Psmd4 G T 3: 94,941,273 (GRCm39) A55E probably damaging Het
Rab36 G A 10: 74,880,328 (GRCm39) V63I probably damaging Het
Rbm26 T A 14: 105,380,270 (GRCm39) T516S probably benign Het
Sdr42e1 G A 8: 118,389,511 (GRCm39) L377F probably damaging Het
Setdb1 T C 3: 95,234,512 (GRCm39) probably benign Het
Uggt2 C T 14: 119,256,919 (GRCm39) S1105N probably benign Het
Zfp113 T C 5: 138,143,219 (GRCm39) N344D probably benign Het
Zfp738 T C 13: 67,818,231 (GRCm39) I587V probably benign Het
Other mutations in Uba3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0295:Uba3 UTSW 6 97,168,544 (GRCm39) missense possibly damaging 0.71
R0554:Uba3 UTSW 6 97,168,221 (GRCm39) splice site probably null
R0780:Uba3 UTSW 6 97,163,666 (GRCm39) nonsense probably null
R1572:Uba3 UTSW 6 97,162,298 (GRCm39) splice site probably benign
R1759:Uba3 UTSW 6 97,173,865 (GRCm39) missense probably damaging 1.00
R1806:Uba3 UTSW 6 97,176,230 (GRCm39) missense possibly damaging 0.87
R2076:Uba3 UTSW 6 97,176,241 (GRCm39) missense probably damaging 1.00
R3237:Uba3 UTSW 6 97,163,201 (GRCm39) missense probably damaging 1.00
R5238:Uba3 UTSW 6 97,178,896 (GRCm39) nonsense probably null
R6293:Uba3 UTSW 6 97,173,869 (GRCm39) missense probably damaging 1.00
R7198:Uba3 UTSW 6 97,182,512 (GRCm39) start codon destroyed probably null 0.02
R8066:Uba3 UTSW 6 97,178,882 (GRCm39) missense probably damaging 0.97
R8087:Uba3 UTSW 6 97,162,344 (GRCm39) missense possibly damaging 0.76
R9016:Uba3 UTSW 6 97,162,694 (GRCm39) nonsense probably null
R9100:Uba3 UTSW 6 97,163,671 (GRCm39) missense probably damaging 0.99
R9356:Uba3 UTSW 6 97,161,811 (GRCm39) missense probably benign 0.08
R9459:Uba3 UTSW 6 97,166,559 (GRCm39) missense probably benign 0.00
R9582:Uba3 UTSW 6 97,168,491 (GRCm39) missense probably damaging 0.96
R9801:Uba3 UTSW 6 97,162,635 (GRCm39) missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- CTTCAGGGCTACAAACAGGG -3'
(R):5'- AGTGCTTCCCCATACCAGAC -3'

Sequencing Primer
(F):5'- GCTACAAACAGGGAAATATGTCTTAG -3'
(R):5'- TGGGAAAATAGAACCACAACTCAG -3'
Posted On 2015-01-23