Incidental Mutation 'R2907:Uba3'
ID261688
Institutional Source Beutler Lab
Gene Symbol Uba3
Ensembl Gene ENSMUSG00000030061
Gene Nameubiquitin-like modifier activating enzyme 3
Synonymsubiquitin activating enzyme 3, A830034N06Rik, Ube1c
MMRRC Submission 040494-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2907 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location97183670-97205647 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97203553 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 21 (E21G)
Ref Sequence ENSEMBL: ENSMUSP00000130954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089287] [ENSMUST00000164744] [ENSMUST00000204056]
Predicted Effect probably benign
Transcript: ENSMUST00000089287
AA Change: E35G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000086701
Gene: ENSMUSG00000030061
AA Change: E35G

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:ThiF 53 369 2.6e-69 PFAM
E2_bind 374 462 1.02e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164744
AA Change: E21G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000130954
Gene: ENSMUSG00000030061
AA Change: E21G

DomainStartEndE-ValueType
Pfam:ThiF 54 199 1.5e-41 PFAM
Pfam:UBA_e1_thiolCys 202 248 8.7e-15 PFAM
Pfam:UBACT 255 321 9e-25 PFAM
E2_bind 360 448 1.02e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203215
Predicted Effect probably benign
Transcript: ENSMUST00000204056
SMART Domains Protein: ENSMUSP00000145309
Gene: ENSMUSG00000030061

DomainStartEndE-ValueType
low complexity region 5 56 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204391
Meta Mutation Damage Score 0.0631 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: The protein encoded by this gene is the catalytic subunit of the enzyme that activates NEDD8, a ubiquitin-like molecule that binds to its target proteins through an enzymatic reaction analagous to ubiquitylation. Embryonic mice deficient for this protein die prior to implantation and display apoptosis of the inner cell mass. Trophoblastic cells cannot enter S phase, demonstrating that this gene is required for cell cycle progression during embryogenesis. Two pseudogenes have been found for this gene. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mutants die at the peri-implantation stage. Mutants exhibit selective apoptosis of the inner cell mass but not of trophoblastic cells. Moreover, the trophoblastic cells fail to enter the S phase of the endoreduplication cycle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,567,297 E385G probably damaging Het
Adam32 A T 8: 24,863,504 W690R probably damaging Het
Ap1b1 T A 11: 5,031,641 N516K probably damaging Het
Arap3 G A 18: 37,990,527 P452L possibly damaging Het
Armcx6 A T X: 134,749,450 C211S probably damaging Het
Asns A G 6: 7,675,506 S499P probably benign Het
Aspn G T 13: 49,551,898 V79F probably damaging Het
Astn2 A G 4: 65,644,856 I844T possibly damaging Het
Asxl3 A T 18: 22,517,273 H773L possibly damaging Het
Atp7b G A 8: 22,011,554 T781I probably damaging Het
Bcl6 G A 16: 23,968,119 R641W probably damaging Het
Csmd3 T A 15: 48,011,053 I612F probably damaging Het
Dnm1l A T 16: 16,314,311 S666T probably damaging Het
Gucy2c A T 6: 136,708,387 V852E probably damaging Het
H2-T3 G A 17: 36,187,455 R233C possibly damaging Het
Igfbp4 A G 11: 99,041,551 probably benign Het
Igkv16-104 T C 6: 68,425,927 I68T probably damaging Het
Kansl1 T A 11: 104,424,460 S251C possibly damaging Het
Kcnk1 G T 8: 125,995,799 V114L probably benign Het
Klra3 G T 6: 130,333,339 Q73K probably damaging Het
Mcpt1 T C 14: 56,020,123 V242A probably damaging Het
Nek10 C A 14: 14,980,613 Q990K possibly damaging Het
Nlrp4d A T 7: 10,378,427 V605E probably benign Het
Olfr1176 T C 2: 88,340,483 I306T probably benign Het
Olfr1437 T C 19: 12,322,668 D53G probably damaging Het
Olfr1490 C T 19: 13,655,247 P268S possibly damaging Het
Osbpl1a A G 18: 12,871,072 probably benign Het
Otud4 T A 8: 79,673,068 S803T probably benign Het
Pax9 C T 12: 56,709,744 T289I probably benign Het
Pcdha5 A C 18: 36,960,815 I126L possibly damaging Het
Psmd4 G T 3: 95,033,962 A55E probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rbm26 T A 14: 105,142,834 T516S probably benign Het
Sdr42e1 G A 8: 117,662,772 L377F probably damaging Het
Setdb1 T C 3: 95,327,201 probably benign Het
Uggt2 C T 14: 119,019,507 S1105N probably benign Het
Zfp113 T C 5: 138,144,957 N344D probably benign Het
Zfp738 T C 13: 67,670,112 I587V probably benign Het
Other mutations in Uba3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0295:Uba3 UTSW 6 97191583 missense possibly damaging 0.71
R0554:Uba3 UTSW 6 97191260 splice site probably null
R0780:Uba3 UTSW 6 97186705 nonsense probably null
R1572:Uba3 UTSW 6 97185337 splice site probably benign
R1759:Uba3 UTSW 6 97196904 missense probably damaging 1.00
R1806:Uba3 UTSW 6 97199269 missense possibly damaging 0.87
R2076:Uba3 UTSW 6 97199280 missense probably damaging 1.00
R3237:Uba3 UTSW 6 97186240 missense probably damaging 1.00
R5238:Uba3 UTSW 6 97201935 nonsense probably null
R6293:Uba3 UTSW 6 97196908 missense probably damaging 1.00
R7198:Uba3 UTSW 6 97205551 start codon destroyed probably null 0.02
R8066:Uba3 UTSW 6 97201921 missense probably damaging 0.97
R8087:Uba3 UTSW 6 97185383 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- CTTCAGGGCTACAAACAGGG -3'
(R):5'- AGTGCTTCCCCATACCAGAC -3'

Sequencing Primer
(F):5'- GCTACAAACAGGGAAATATGTCTTAG -3'
(R):5'- TGGGAAAATAGAACCACAACTCAG -3'
Posted On2015-01-23