Incidental Mutation 'R2907:Klra3'
ID261689
Institutional Source Beutler Lab
Gene Symbol Klra3
Ensembl Gene ENSMUSG00000067591
Gene Namekiller cell lectin-like receptor, subfamily A, member 3
SynonymsNK-2.1, Nk2.1, Ly49C, Nk-2, Nk2, Ly49c, 5E6
MMRRC Submission 040494-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R2907 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location130323289-130337574 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 130333339 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 73 (Q73K)
Ref Sequence ENSEMBL: ENSMUSP00000107629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088017] [ENSMUST00000111998]
Predicted Effect probably damaging
Transcript: ENSMUST00000088017
AA Change: Q73K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000085333
Gene: ENSMUSG00000067591
AA Change: Q73K

DomainStartEndE-ValueType
low complexity region 56 66 N/A INTRINSIC
Blast:CLECT 73 117 1e-7 BLAST
CLECT 143 258 7.11e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111998
AA Change: Q73K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107629
Gene: ENSMUSG00000067591
AA Change: Q73K

DomainStartEndE-ValueType
low complexity region 56 66 N/A INTRINSIC
Blast:CLECT 73 117 1e-7 BLAST
CLECT 143 258 7.11e-16 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,567,297 E385G probably damaging Het
Adam32 A T 8: 24,863,504 W690R probably damaging Het
Ap1b1 T A 11: 5,031,641 N516K probably damaging Het
Arap3 G A 18: 37,990,527 P452L possibly damaging Het
Armcx6 A T X: 134,749,450 C211S probably damaging Het
Asns A G 6: 7,675,506 S499P probably benign Het
Aspn G T 13: 49,551,898 V79F probably damaging Het
Astn2 A G 4: 65,644,856 I844T possibly damaging Het
Asxl3 A T 18: 22,517,273 H773L possibly damaging Het
Atp7b G A 8: 22,011,554 T781I probably damaging Het
Bcl6 G A 16: 23,968,119 R641W probably damaging Het
Csmd3 T A 15: 48,011,053 I612F probably damaging Het
Dnm1l A T 16: 16,314,311 S666T probably damaging Het
Gucy2c A T 6: 136,708,387 V852E probably damaging Het
H2-T3 G A 17: 36,187,455 R233C possibly damaging Het
Igfbp4 A G 11: 99,041,551 probably benign Het
Igkv16-104 T C 6: 68,425,927 I68T probably damaging Het
Kansl1 T A 11: 104,424,460 S251C possibly damaging Het
Kcnk1 G T 8: 125,995,799 V114L probably benign Het
Mcpt1 T C 14: 56,020,123 V242A probably damaging Het
Nek10 C A 14: 14,980,613 Q990K possibly damaging Het
Nlrp4d A T 7: 10,378,427 V605E probably benign Het
Olfr1176 T C 2: 88,340,483 I306T probably benign Het
Olfr1437 T C 19: 12,322,668 D53G probably damaging Het
Olfr1490 C T 19: 13,655,247 P268S possibly damaging Het
Osbpl1a A G 18: 12,871,072 probably benign Het
Otud4 T A 8: 79,673,068 S803T probably benign Het
Pax9 C T 12: 56,709,744 T289I probably benign Het
Pcdha5 A C 18: 36,960,815 I126L possibly damaging Het
Psmd4 G T 3: 95,033,962 A55E probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rbm26 T A 14: 105,142,834 T516S probably benign Het
Sdr42e1 G A 8: 117,662,772 L377F probably damaging Het
Setdb1 T C 3: 95,327,201 probably benign Het
Uba3 T C 6: 97,203,553 E21G probably benign Het
Uggt2 C T 14: 119,019,507 S1105N probably benign Het
Zfp113 T C 5: 138,144,957 N344D probably benign Het
Zfp738 T C 13: 67,670,112 I587V probably benign Het
Other mutations in Klra3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Klra3 APN 6 130327144 missense probably benign 0.26
R0004:Klra3 UTSW 6 130323687 missense probably damaging 1.00
R1532:Klra3 UTSW 6 130333144 missense probably benign 0.12
R1533:Klra3 UTSW 6 130333144 missense probably benign 0.12
R1534:Klra3 UTSW 6 130333144 missense probably benign 0.12
R1536:Klra3 UTSW 6 130333144 missense probably benign 0.12
R1547:Klra3 UTSW 6 130333144 missense probably benign 0.12
R1548:Klra3 UTSW 6 130333144 missense probably benign 0.12
R1566:Klra3 UTSW 6 130333144 missense probably benign 0.12
R1567:Klra3 UTSW 6 130333144 missense probably benign 0.12
R1769:Klra3 UTSW 6 130330263 critical splice acceptor site probably null
R1772:Klra3 UTSW 6 130323708 missense probably benign
R1806:Klra3 UTSW 6 130327070 missense probably damaging 0.99
R2131:Klra3 UTSW 6 130335775 missense probably benign 0.07
R2138:Klra3 UTSW 6 130333158 missense probably benign 0.00
R2152:Klra3 UTSW 6 130333144 missense probably benign 0.12
R2154:Klra3 UTSW 6 130333144 missense probably benign 0.12
R2906:Klra3 UTSW 6 130333339 missense probably damaging 0.99
R4287:Klra3 UTSW 6 130334302 missense probably benign 0.08
R4732:Klra3 UTSW 6 130327132 missense possibly damaging 0.94
R4733:Klra3 UTSW 6 130327132 missense possibly damaging 0.94
R4829:Klra3 UTSW 6 130323616 missense probably benign 0.05
R5308:Klra3 UTSW 6 130334307 splice site probably null
R6701:Klra3 UTSW 6 130330253 missense probably benign 0.01
R7019:Klra3 UTSW 6 130327124 missense probably damaging 1.00
R7174:Klra3 UTSW 6 130335978 splice site probably null
R8542:Klra3 UTSW 6 130333133 critical splice donor site probably null
X0052:Klra3 UTSW 6 130333180 missense probably damaging 0.99
Z1176:Klra3 UTSW 6 130335721 nonsense probably null
Z1177:Klra3 UTSW 6 130330121 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACATACCTGTGTCCCGTGAG -3'
(R):5'- ACTCCATATGCTCCAAGAAGAATTG -3'

Sequencing Primer
(F):5'- CGTGAGGAATCTAAAACAGTCTTTG -3'
(R):5'- AGTTGAAGTGAATGGAAGTTACTTC -3'
Posted On2015-01-23