Incidental Mutation 'R2907:Adam32'
ID261693
Institutional Source Beutler Lab
Gene Symbol Adam32
Ensembl Gene ENSMUSG00000037437
Gene Namea disintegrin and metallopeptidase domain 32
Synonyms
MMRRC Submission 040494-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2907 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location24836140-24948804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24863504 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 690 (W690R)
Ref Sequence ENSEMBL: ENSMUSP00000113627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119720] [ENSMUST00000121438] [ENSMUST00000173069] [ENSMUST00000173559]
Predicted Effect probably benign
Transcript: ENSMUST00000119720
SMART Domains Protein: ENSMUSP00000113076
Gene: ENSMUSG00000037437

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 32 145 4.5e-32 PFAM
Pfam:Reprolysin 187 384 4.1e-66 PFAM
Pfam:Reprolysin_3 211 318 6.2e-7 PFAM
DISIN 400 481 2.69e-16 SMART
ACR 482 622 6.83e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121438
AA Change: W690R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113627
Gene: ENSMUSG00000037437
AA Change: W690R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 24 145 8.4e-26 PFAM
Pfam:Reprolysin 187 384 1.3e-68 PFAM
DISIN 400 481 2.69e-16 SMART
ACR 482 622 6.83e-38 SMART
EGF 631 660 1.73e0 SMART
transmembrane domain 689 711 N/A INTRINSIC
low complexity region 719 754 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140573
SMART Domains Protein: ENSMUSP00000133843
Gene: ENSMUSG00000037437

DomainStartEndE-ValueType
Blast:DISIN 2 22 5e-7 BLAST
Pfam:ADAM_CR 24 71 1.3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156719
Predicted Effect probably benign
Transcript: ENSMUST00000173069
SMART Domains Protein: ENSMUSP00000133631
Gene: ENSMUSG00000037437

DomainStartEndE-ValueType
Blast:ACR 1 46 7e-25 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173559
Meta Mutation Damage Score 0.6169 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: This gene encodes a member of the disintegrin family of membrane-anchored proteins that play a role in diverse biological processes such as brain development, fertilization, tumor development and inflammation. The encoded protein undergoes proteolytic processing to generate a mature polypeptide comprised of an metalloprotease, disintegrin and epidermal growth factor-like domains. This gene was found to be expressed predominantly in the pachytene spermatocytes, where the processed protein is localized to the sperm surface. This gene is located in a cluster of other disintegrin and metallopeptidase family genes on chromosome 8. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,567,297 E385G probably damaging Het
Ap1b1 T A 11: 5,031,641 N516K probably damaging Het
Arap3 G A 18: 37,990,527 P452L possibly damaging Het
Armcx6 A T X: 134,749,450 C211S probably damaging Het
Asns A G 6: 7,675,506 S499P probably benign Het
Aspn G T 13: 49,551,898 V79F probably damaging Het
Astn2 A G 4: 65,644,856 I844T possibly damaging Het
Asxl3 A T 18: 22,517,273 H773L possibly damaging Het
Atp7b G A 8: 22,011,554 T781I probably damaging Het
Bcl6 G A 16: 23,968,119 R641W probably damaging Het
Csmd3 T A 15: 48,011,053 I612F probably damaging Het
Dnm1l A T 16: 16,314,311 S666T probably damaging Het
Gucy2c A T 6: 136,708,387 V852E probably damaging Het
H2-T3 G A 17: 36,187,455 R233C possibly damaging Het
Igfbp4 A G 11: 99,041,551 probably benign Het
Igkv16-104 T C 6: 68,425,927 I68T probably damaging Het
Kansl1 T A 11: 104,424,460 S251C possibly damaging Het
Kcnk1 G T 8: 125,995,799 V114L probably benign Het
Klra3 G T 6: 130,333,339 Q73K probably damaging Het
Mcpt1 T C 14: 56,020,123 V242A probably damaging Het
Nek10 C A 14: 14,980,613 Q990K possibly damaging Het
Nlrp4d A T 7: 10,378,427 V605E probably benign Het
Olfr1176 T C 2: 88,340,483 I306T probably benign Het
Olfr1437 T C 19: 12,322,668 D53G probably damaging Het
Olfr1490 C T 19: 13,655,247 P268S possibly damaging Het
Osbpl1a A G 18: 12,871,072 probably benign Het
Otud4 T A 8: 79,673,068 S803T probably benign Het
Pax9 C T 12: 56,709,744 T289I probably benign Het
Pcdha5 A C 18: 36,960,815 I126L possibly damaging Het
Psmd4 G T 3: 95,033,962 A55E probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rbm26 T A 14: 105,142,834 T516S probably benign Het
Sdr42e1 G A 8: 117,662,772 L377F probably damaging Het
Setdb1 T C 3: 95,327,201 probably benign Het
Uba3 T C 6: 97,203,553 E21G probably benign Het
Uggt2 C T 14: 119,019,507 S1105N probably benign Het
Zfp113 T C 5: 138,144,957 N344D probably benign Het
Zfp738 T C 13: 67,670,112 I587V probably benign Het
Other mutations in Adam32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00775:Adam32 APN 8 24921354 missense probably damaging 1.00
IGL00793:Adam32 APN 8 24837830 splice site probably benign
IGL01317:Adam32 APN 8 24872581 missense probably damaging 1.00
IGL01475:Adam32 APN 8 24872648 missense probably damaging 1.00
IGL01501:Adam32 APN 8 24914353 missense probably damaging 1.00
IGL01659:Adam32 APN 8 24870774 splice site probably benign
IGL01994:Adam32 APN 8 24902796 splice site probably benign
IGL02137:Adam32 APN 8 24872594 missense probably damaging 1.00
IGL02393:Adam32 APN 8 24920053 missense probably damaging 1.00
IGL02516:Adam32 APN 8 24898596 missense probably damaging 1.00
IGL02892:Adam32 APN 8 24878711 intron probably benign
IGL02929:Adam32 APN 8 24872643 missense possibly damaging 0.81
IGL03273:Adam32 APN 8 24921340 missense probably damaging 1.00
PIT4515001:Adam32 UTSW 8 24914326 missense possibly damaging 0.88
R0088:Adam32 UTSW 8 24914067 missense probably damaging 1.00
R0098:Adam32 UTSW 8 24914389 missense possibly damaging 0.79
R0098:Adam32 UTSW 8 24914389 missense possibly damaging 0.79
R0189:Adam32 UTSW 8 24922337 critical splice acceptor site probably null
R1740:Adam32 UTSW 8 24921298 missense probably damaging 1.00
R1853:Adam32 UTSW 8 24898626 missense probably benign 0.02
R2090:Adam32 UTSW 8 24901440 critical splice donor site probably null
R2906:Adam32 UTSW 8 24863504 missense probably damaging 1.00
R4304:Adam32 UTSW 8 24901529 missense probably damaging 1.00
R4612:Adam32 UTSW 8 24872736 missense probably damaging 1.00
R4673:Adam32 UTSW 8 24884455 missense probably damaging 1.00
R4786:Adam32 UTSW 8 24863493 missense probably damaging 1.00
R5292:Adam32 UTSW 8 24864451 missense possibly damaging 0.85
R5398:Adam32 UTSW 8 24872579 missense possibly damaging 0.95
R5524:Adam32 UTSW 8 24922312 missense probably damaging 0.99
R5939:Adam32 UTSW 8 24914122 missense probably damaging 1.00
R6350:Adam32 UTSW 8 24863429 missense possibly damaging 0.86
R6766:Adam32 UTSW 8 24872630 missense probably damaging 0.96
R6893:Adam32 UTSW 8 24878754 missense probably damaging 1.00
R7095:Adam32 UTSW 8 24914070 missense probably damaging 1.00
R7241:Adam32 UTSW 8 24898494 missense probably benign 0.00
R7457:Adam32 UTSW 8 24884619 missense probably damaging 0.98
R7864:Adam32 UTSW 8 24922276 missense probably benign 0.11
R7947:Adam32 UTSW 8 24922276 missense probably benign 0.11
Z1176:Adam32 UTSW 8 24948750 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACACTTTATGTAGCAAGGTCCTAATG -3'
(R):5'- TCCATGTCTTGGGGTCGATC -3'

Sequencing Primer
(F):5'- GCAAGGTCCTAATGCTACTTTAATG -3'
(R):5'- GCCTTCTAATGGCTCACAT -3'
Posted On2015-01-23