Incidental Mutation 'R2907:Otud4'
ID261694
Institutional Source Beutler Lab
Gene Symbol Otud4
Ensembl Gene ENSMUSG00000036990
Gene NameOTU domain containing 4
Synonyms4930431L18Rik, D8Ertd69e
MMRRC Submission 040494-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R2907 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location79639618-79677724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79673068 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 803 (S803T)
Ref Sequence ENSEMBL: ENSMUSP00000134097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173078] [ENSMUST00000173286]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172614
Predicted Effect probably benign
Transcript: ENSMUST00000173078
AA Change: S804T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000133939
Gene: ENSMUSG00000036990
AA Change: S804T

DomainStartEndE-ValueType
Pfam:OTU 40 154 3.4e-17 PFAM
low complexity region 189 213 N/A INTRINSIC
Blast:TUDOR 280 335 2e-7 BLAST
low complexity region 392 405 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 543 555 N/A INTRINSIC
low complexity region 1014 1025 N/A INTRINSIC
low complexity region 1082 1104 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173286
AA Change: S803T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000134097
Gene: ENSMUSG00000036990
AA Change: S803T

DomainStartEndE-ValueType
Pfam:OTU 40 149 5.3e-21 PFAM
low complexity region 189 213 N/A INTRINSIC
Blast:TUDOR 280 334 9e-9 BLAST
low complexity region 391 404 N/A INTRINSIC
low complexity region 472 485 N/A INTRINSIC
low complexity region 542 554 N/A INTRINSIC
low complexity region 1013 1024 N/A INTRINSIC
low complexity region 1081 1103 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174485
Meta Mutation Damage Score 0.0587 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alternatively spliced transcript variants have been found for this gene. The smaller protein isoform encoded by the shorter transcript variant is found only in HIV-1 infected cells. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,567,297 E385G probably damaging Het
Adam32 A T 8: 24,863,504 W690R probably damaging Het
Ap1b1 T A 11: 5,031,641 N516K probably damaging Het
Arap3 G A 18: 37,990,527 P452L possibly damaging Het
Armcx6 A T X: 134,749,450 C211S probably damaging Het
Asns A G 6: 7,675,506 S499P probably benign Het
Aspn G T 13: 49,551,898 V79F probably damaging Het
Astn2 A G 4: 65,644,856 I844T possibly damaging Het
Asxl3 A T 18: 22,517,273 H773L possibly damaging Het
Atp7b G A 8: 22,011,554 T781I probably damaging Het
Bcl6 G A 16: 23,968,119 R641W probably damaging Het
Csmd3 T A 15: 48,011,053 I612F probably damaging Het
Dnm1l A T 16: 16,314,311 S666T probably damaging Het
Gucy2c A T 6: 136,708,387 V852E probably damaging Het
H2-T3 G A 17: 36,187,455 R233C possibly damaging Het
Igfbp4 A G 11: 99,041,551 probably benign Het
Igkv16-104 T C 6: 68,425,927 I68T probably damaging Het
Kansl1 T A 11: 104,424,460 S251C possibly damaging Het
Kcnk1 G T 8: 125,995,799 V114L probably benign Het
Klra3 G T 6: 130,333,339 Q73K probably damaging Het
Mcpt1 T C 14: 56,020,123 V242A probably damaging Het
Nek10 C A 14: 14,980,613 Q990K possibly damaging Het
Nlrp4d A T 7: 10,378,427 V605E probably benign Het
Olfr1176 T C 2: 88,340,483 I306T probably benign Het
Olfr1437 T C 19: 12,322,668 D53G probably damaging Het
Olfr1490 C T 19: 13,655,247 P268S possibly damaging Het
Osbpl1a A G 18: 12,871,072 probably benign Het
Pax9 C T 12: 56,709,744 T289I probably benign Het
Pcdha5 A C 18: 36,960,815 I126L possibly damaging Het
Psmd4 G T 3: 95,033,962 A55E probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rbm26 T A 14: 105,142,834 T516S probably benign Het
Sdr42e1 G A 8: 117,662,772 L377F probably damaging Het
Setdb1 T C 3: 95,327,201 probably benign Het
Uba3 T C 6: 97,203,553 E21G probably benign Het
Uggt2 C T 14: 119,019,507 S1105N probably benign Het
Zfp113 T C 5: 138,144,957 N344D probably benign Het
Zfp738 T C 13: 67,670,112 I587V probably benign Het
Other mutations in Otud4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Otud4 APN 8 79672881 missense probably damaging 0.99
IGL01353:Otud4 APN 8 79665021 missense probably benign
IGL01371:Otud4 APN 8 79673761 missense probably damaging 1.00
IGL01782:Otud4 APN 8 79673011 missense possibly damaging 0.95
IGL01912:Otud4 APN 8 79673837 missense probably benign
IGL02294:Otud4 APN 8 79664977 splice site probably benign
IGL02830:Otud4 APN 8 79673301 missense probably benign 0.00
IGL03063:Otud4 APN 8 79663790 missense probably benign 0.01
IGL03077:Otud4 APN 8 79673458 missense probably damaging 0.97
R0437:Otud4 UTSW 8 79669997 missense probably benign 0.02
R1024:Otud4 UTSW 8 79664093 missense probably benign 0.01
R1118:Otud4 UTSW 8 79653351 splice site probably benign
R1296:Otud4 UTSW 8 79673974 missense unknown
R1321:Otud4 UTSW 8 79669950 missense probably benign 0.03
R1674:Otud4 UTSW 8 79673147 missense probably benign 0.12
R1736:Otud4 UTSW 8 79651665 splice site probably benign
R1815:Otud4 UTSW 8 79639989 nonsense probably null
R1950:Otud4 UTSW 8 79646332 missense probably damaging 0.99
R1985:Otud4 UTSW 8 79640012 missense probably damaging 1.00
R2173:Otud4 UTSW 8 79668464 missense probably damaging 1.00
R2869:Otud4 UTSW 8 79661073 missense possibly damaging 0.82
R2869:Otud4 UTSW 8 79661073 missense possibly damaging 0.82
R2870:Otud4 UTSW 8 79661073 missense possibly damaging 0.82
R2870:Otud4 UTSW 8 79661073 missense possibly damaging 0.82
R2872:Otud4 UTSW 8 79661073 missense possibly damaging 0.82
R2872:Otud4 UTSW 8 79661073 missense possibly damaging 0.82
R3545:Otud4 UTSW 8 79665055 missense probably damaging 1.00
R4628:Otud4 UTSW 8 79639968 missense possibly damaging 0.73
R4790:Otud4 UTSW 8 79666773 missense possibly damaging 0.82
R4989:Otud4 UTSW 8 79655689 missense probably damaging 1.00
R5133:Otud4 UTSW 8 79655689 missense probably damaging 1.00
R5134:Otud4 UTSW 8 79655689 missense probably damaging 1.00
R5294:Otud4 UTSW 8 79672892 missense possibly damaging 0.54
R5410:Otud4 UTSW 8 79672997 missense probably benign 0.04
R5454:Otud4 UTSW 8 79651042 missense possibly damaging 0.94
R5579:Otud4 UTSW 8 79664108 missense probably benign
R5738:Otud4 UTSW 8 79673461 missense probably benign 0.02
R5886:Otud4 UTSW 8 79672807 missense probably damaging 1.00
R6062:Otud4 UTSW 8 79673896 missense probably damaging 1.00
R6364:Otud4 UTSW 8 79646341 missense probably damaging 0.99
R6427:Otud4 UTSW 8 79668497 missense probably benign 0.00
R6450:Otud4 UTSW 8 79672997 missense probably benign 0.04
R6744:Otud4 UTSW 8 79673778 nonsense probably null
R6773:Otud4 UTSW 8 79643806 missense possibly damaging 0.95
R7046:Otud4 UTSW 8 79651042 missense possibly damaging 0.94
R7142:Otud4 UTSW 8 79672762 splice site probably null
R7420:Otud4 UTSW 8 79664108 missense probably benign 0.11
R7470:Otud4 UTSW 8 79673360 missense probably benign 0.00
R7736:Otud4 UTSW 8 79655765 missense possibly damaging 0.53
X0024:Otud4 UTSW 8 79646310 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGCAGGATGTACCCAAAGG -3'
(R):5'- GGATACCCATACCAAACATGAGGG -3'

Sequencing Primer
(F):5'- GGATGTACCCAAAGGTCCCTGTTC -3'
(R):5'- CCCATACCAAACATGAGGGAAGAAAG -3'
Posted On2015-01-23