Incidental Mutation 'R2907:Sdr42e1'
ID261695
Institutional Source Beutler Lab
Gene Symbol Sdr42e1
Ensembl Gene ENSMUSG00000034308
Gene Nameshort chain dehydrogenase/reductase family 42E, member 1
Synonyms
MMRRC Submission 040494-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2907 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location117661399-117673689 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 117662772 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 377 (L377F)
Ref Sequence ENSEMBL: ENSMUSP00000133782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037955] [ENSMUST00000173522] [ENSMUST00000174450]
Predicted Effect probably damaging
Transcript: ENSMUST00000037955
AA Change: L377F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044457
Gene: ENSMUSG00000034308
AA Change: L377F

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 9 241 4.2e-14 PFAM
Pfam:Polysacc_synt_2 11 129 7.1e-11 PFAM
Pfam:NAD_binding_10 11 239 3.3e-10 PFAM
Pfam:Epimerase 11 255 6.7e-29 PFAM
Pfam:3Beta_HSD 12 285 3.1e-69 PFAM
Pfam:NAD_binding_4 27 233 7.1e-14 PFAM
transmembrane domain 367 389 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173522
AA Change: L377F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133782
Gene: ENSMUSG00000034308
AA Change: L377F

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 9 208 2.4e-13 PFAM
Pfam:Polysacc_synt_2 11 129 5.2e-11 PFAM
Pfam:Epimerase 11 250 4.3e-28 PFAM
Pfam:GDP_Man_Dehyd 12 273 1.3e-9 PFAM
Pfam:3Beta_HSD 12 285 4.7e-69 PFAM
Pfam:NAD_binding_4 27 233 2.1e-11 PFAM
transmembrane domain 367 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174450
SMART Domains Protein: ENSMUSP00000133837
Gene: ENSMUSG00000034308

DomainStartEndE-ValueType
Pfam:adh_short 9 136 1.1e-6 PFAM
Pfam:RmlD_sub_bind 9 184 6.7e-15 PFAM
Pfam:Polysacc_synt_2 11 129 6e-12 PFAM
Pfam:Epimerase 11 176 1.8e-21 PFAM
Pfam:NAD_binding_10 11 189 4.8e-10 PFAM
Pfam:3Beta_HSD 12 189 5.4e-43 PFAM
Pfam:NAD_binding_4 25 186 6.6e-11 PFAM
Meta Mutation Damage Score 0.1928 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,567,297 E385G probably damaging Het
Adam32 A T 8: 24,863,504 W690R probably damaging Het
Ap1b1 T A 11: 5,031,641 N516K probably damaging Het
Arap3 G A 18: 37,990,527 P452L possibly damaging Het
Armcx6 A T X: 134,749,450 C211S probably damaging Het
Asns A G 6: 7,675,506 S499P probably benign Het
Aspn G T 13: 49,551,898 V79F probably damaging Het
Astn2 A G 4: 65,644,856 I844T possibly damaging Het
Asxl3 A T 18: 22,517,273 H773L possibly damaging Het
Atp7b G A 8: 22,011,554 T781I probably damaging Het
Bcl6 G A 16: 23,968,119 R641W probably damaging Het
Csmd3 T A 15: 48,011,053 I612F probably damaging Het
Dnm1l A T 16: 16,314,311 S666T probably damaging Het
Gucy2c A T 6: 136,708,387 V852E probably damaging Het
H2-T3 G A 17: 36,187,455 R233C possibly damaging Het
Igfbp4 A G 11: 99,041,551 probably benign Het
Igkv16-104 T C 6: 68,425,927 I68T probably damaging Het
Kansl1 T A 11: 104,424,460 S251C possibly damaging Het
Kcnk1 G T 8: 125,995,799 V114L probably benign Het
Klra3 G T 6: 130,333,339 Q73K probably damaging Het
Mcpt1 T C 14: 56,020,123 V242A probably damaging Het
Nek10 C A 14: 14,980,613 Q990K possibly damaging Het
Nlrp4d A T 7: 10,378,427 V605E probably benign Het
Olfr1176 T C 2: 88,340,483 I306T probably benign Het
Olfr1437 T C 19: 12,322,668 D53G probably damaging Het
Olfr1490 C T 19: 13,655,247 P268S possibly damaging Het
Osbpl1a A G 18: 12,871,072 probably benign Het
Otud4 T A 8: 79,673,068 S803T probably benign Het
Pax9 C T 12: 56,709,744 T289I probably benign Het
Pcdha5 A C 18: 36,960,815 I126L possibly damaging Het
Psmd4 G T 3: 95,033,962 A55E probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rbm26 T A 14: 105,142,834 T516S probably benign Het
Setdb1 T C 3: 95,327,201 probably benign Het
Uba3 T C 6: 97,203,553 E21G probably benign Het
Uggt2 C T 14: 119,019,507 S1105N probably benign Het
Zfp113 T C 5: 138,144,957 N344D probably benign Het
Zfp738 T C 13: 67,670,112 I587V probably benign Het
Other mutations in Sdr42e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Sdr42e1 APN 8 117663443 missense probably damaging 1.00
IGL01613:Sdr42e1 APN 8 117662937 missense probably benign 0.14
PIT4581001:Sdr42e1 UTSW 8 117663518 missense probably damaging 0.99
R0194:Sdr42e1 UTSW 8 117663109 missense probably damaging 1.00
R1055:Sdr42e1 UTSW 8 117663584 missense probably damaging 0.98
R2108:Sdr42e1 UTSW 8 117665024 missense probably damaging 0.99
R2176:Sdr42e1 UTSW 8 117662877 missense possibly damaging 0.63
R4551:Sdr42e1 UTSW 8 117663608 missense probably benign 0.01
R4651:Sdr42e1 UTSW 8 117663621 missense probably benign 0.01
R5148:Sdr42e1 UTSW 8 117663603 missense probably damaging 1.00
R5240:Sdr42e1 UTSW 8 117663282 missense probably benign 0.00
R6242:Sdr42e1 UTSW 8 117663197 missense possibly damaging 0.87
R7417:Sdr42e1 UTSW 8 117662751 missense probably benign 0.04
R7716:Sdr42e1 UTSW 8 117673647 start gained probably benign
R7995:Sdr42e1 UTSW 8 117663268 missense probably benign 0.00
R8255:Sdr42e1 UTSW 8 117663763 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACTTTTAAGAAGTAATGTGAGGATCC -3'
(R):5'- CAGGCTCTACAACTTCCAGC -3'

Sequencing Primer
(F):5'- TGTGAGGATCCAGGAATGGTACC -3'
(R):5'- TCACCCGCACCGAAGTTTATAAAAC -3'
Posted On2015-01-23