Incidental Mutation 'R2907:Kcnk1'
ID261696
Institutional Source Beutler Lab
Gene Symbol Kcnk1
Ensembl Gene ENSMUSG00000033998
Gene Namepotassium channel, subfamily K, member 1
SynonymsTWIK-1
MMRRC Submission 040494-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2907 (G1)
Quality Score209
Status Validated
Chromosome8
Chromosomal Location125995170-126030685 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 125995799 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 114 (V114L)
Ref Sequence ENSEMBL: ENSMUSP00000046103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046765] [ENSMUST00000212831]
Predicted Effect probably benign
Transcript: ENSMUST00000046765
AA Change: V114L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000046103
Gene: ENSMUSG00000033998
AA Change: V114L

DomainStartEndE-ValueType
low complexity region 23 41 N/A INTRINSIC
low complexity region 49 68 N/A INTRINSIC
Pfam:Ion_trans_2 82 158 6.6e-19 PFAM
Pfam:Ion_trans_2 190 271 1.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212831
AA Change: V114L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1511 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the members of the superfamily of potassium channel proteins containing two pore-forming P domains. The product of this gene has not been shown to be a functional channel, however, it may require other non-pore-forming proteins for activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation reduced urinary flow rates and on a low phosphate diet display an attenuated ability to increase renal phosphate reabsorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,567,297 E385G probably damaging Het
Adam32 A T 8: 24,863,504 W690R probably damaging Het
Ap1b1 T A 11: 5,031,641 N516K probably damaging Het
Arap3 G A 18: 37,990,527 P452L possibly damaging Het
Armcx6 A T X: 134,749,450 C211S probably damaging Het
Asns A G 6: 7,675,506 S499P probably benign Het
Aspn G T 13: 49,551,898 V79F probably damaging Het
Astn2 A G 4: 65,644,856 I844T possibly damaging Het
Asxl3 A T 18: 22,517,273 H773L possibly damaging Het
Atp7b G A 8: 22,011,554 T781I probably damaging Het
Bcl6 G A 16: 23,968,119 R641W probably damaging Het
Csmd3 T A 15: 48,011,053 I612F probably damaging Het
Dnm1l A T 16: 16,314,311 S666T probably damaging Het
Gucy2c A T 6: 136,708,387 V852E probably damaging Het
H2-T3 G A 17: 36,187,455 R233C possibly damaging Het
Igfbp4 A G 11: 99,041,551 probably benign Het
Igkv16-104 T C 6: 68,425,927 I68T probably damaging Het
Kansl1 T A 11: 104,424,460 S251C possibly damaging Het
Klra3 G T 6: 130,333,339 Q73K probably damaging Het
Mcpt1 T C 14: 56,020,123 V242A probably damaging Het
Nek10 C A 14: 14,980,613 Q990K possibly damaging Het
Nlrp4d A T 7: 10,378,427 V605E probably benign Het
Olfr1176 T C 2: 88,340,483 I306T probably benign Het
Olfr1437 T C 19: 12,322,668 D53G probably damaging Het
Olfr1490 C T 19: 13,655,247 P268S possibly damaging Het
Osbpl1a A G 18: 12,871,072 probably benign Het
Otud4 T A 8: 79,673,068 S803T probably benign Het
Pax9 C T 12: 56,709,744 T289I probably benign Het
Pcdha5 A C 18: 36,960,815 I126L possibly damaging Het
Psmd4 G T 3: 95,033,962 A55E probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rbm26 T A 14: 105,142,834 T516S probably benign Het
Sdr42e1 G A 8: 117,662,772 L377F probably damaging Het
Setdb1 T C 3: 95,327,201 probably benign Het
Uba3 T C 6: 97,203,553 E21G probably benign Het
Uggt2 C T 14: 119,019,507 S1105N probably benign Het
Zfp113 T C 5: 138,144,957 N344D probably benign Het
Zfp738 T C 13: 67,670,112 I587V probably benign Het
Other mutations in Kcnk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01345:Kcnk1 APN 8 126025407 missense possibly damaging 0.94
IGL01936:Kcnk1 APN 8 126025087 missense probably damaging 1.00
IGL02447:Kcnk1 APN 8 126025080 missense probably damaging 1.00
IGL02674:Kcnk1 APN 8 126025014 missense probably damaging 1.00
PIT4515001:Kcnk1 UTSW 8 126025342 missense probably damaging 1.00
R0735:Kcnk1 UTSW 8 126025289 missense probably damaging 1.00
R1350:Kcnk1 UTSW 8 126025228 missense probably benign 0.08
R1581:Kcnk1 UTSW 8 125995539 missense possibly damaging 0.50
R1789:Kcnk1 UTSW 8 126025384 missense possibly damaging 0.83
R2035:Kcnk1 UTSW 8 126025369 missense possibly damaging 0.56
R2125:Kcnk1 UTSW 8 125995656 missense probably damaging 0.99
R2906:Kcnk1 UTSW 8 125995799 missense probably benign 0.00
R4710:Kcnk1 UTSW 8 126029528 missense probably damaging 1.00
R5698:Kcnk1 UTSW 8 126025405 missense probably damaging 1.00
R6591:Kcnk1 UTSW 8 126025231 missense probably benign 0.01
R6647:Kcnk1 UTSW 8 125995460 start codon destroyed probably null 0.98
R6691:Kcnk1 UTSW 8 126025231 missense probably benign 0.01
R6934:Kcnk1 UTSW 8 126025390 missense probably damaging 1.00
R7059:Kcnk1 UTSW 8 126029727 nonsense probably null
R7082:Kcnk1 UTSW 8 125995548 missense probably damaging 1.00
R7441:Kcnk1 UTSW 8 125995568 missense probably damaging 1.00
R7596:Kcnk1 UTSW 8 125995611 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGCCTTATGAGGACCTGCTG -3'
(R):5'- AGTGAATGAGACCCCTGCAG -3'

Sequencing Primer
(F):5'- GCCAGGAGCTGCGCAAG -3'
(R):5'- CCTCAAGGTCCAGAGTGTTTGAGAC -3'
Posted On2015-01-23