Incidental Mutation 'R2907:Igfbp4'
ID261700
Institutional Source Beutler Lab
Gene Symbol Igfbp4
Ensembl Gene ENSMUSG00000017493
Gene Nameinsulin-like growth factor binding protein 4
SynonymsDeb2, Band 3A, IGFBP-4
MMRRC Submission 040494-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R2907 (G1)
Quality Score170
Status Validated
Chromosome11
Chromosomal Location99041244-99054392 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 99041551 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000017637]
Predicted Effect unknown
Transcript: ENSMUST00000017637
AA Change: S19G
SMART Domains Protein: ENSMUSP00000017637
Gene: ENSMUSG00000017493
AA Change: S19G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IB 25 102 1.13e-36 SMART
TY 197 249 8.2e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130530
Predicted Effect probably benign
Transcript: ENSMUST00000177092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177105
Meta Mutation Damage Score 0.0600 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the insulin-like growth factor binding protein (IGFBP) family and encodes a protein with an IGFBP domain and a thyroglobulin type-I domain. The protein binds both insulin-like growth factors (IGFs) I and II and circulates in the plasma in both glycosylated and non-glycosylated forms. Binding of this protein prolongs the half-life of the IGFs and alters their interaction with cell surface receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a similar reduction in birth and postnatal body weight, and show impaired glucose homeostasis relative to wild-type controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,567,297 E385G probably damaging Het
Adam32 A T 8: 24,863,504 W690R probably damaging Het
Ap1b1 T A 11: 5,031,641 N516K probably damaging Het
Arap3 G A 18: 37,990,527 P452L possibly damaging Het
Armcx6 A T X: 134,749,450 C211S probably damaging Het
Asns A G 6: 7,675,506 S499P probably benign Het
Aspn G T 13: 49,551,898 V79F probably damaging Het
Astn2 A G 4: 65,644,856 I844T possibly damaging Het
Asxl3 A T 18: 22,517,273 H773L possibly damaging Het
Atp7b G A 8: 22,011,554 T781I probably damaging Het
Bcl6 G A 16: 23,968,119 R641W probably damaging Het
Csmd3 T A 15: 48,011,053 I612F probably damaging Het
Dnm1l A T 16: 16,314,311 S666T probably damaging Het
Gucy2c A T 6: 136,708,387 V852E probably damaging Het
H2-T3 G A 17: 36,187,455 R233C possibly damaging Het
Igkv16-104 T C 6: 68,425,927 I68T probably damaging Het
Kansl1 T A 11: 104,424,460 S251C possibly damaging Het
Kcnk1 G T 8: 125,995,799 V114L probably benign Het
Klra3 G T 6: 130,333,339 Q73K probably damaging Het
Mcpt1 T C 14: 56,020,123 V242A probably damaging Het
Nek10 C A 14: 14,980,613 Q990K possibly damaging Het
Nlrp4d A T 7: 10,378,427 V605E probably benign Het
Olfr1176 T C 2: 88,340,483 I306T probably benign Het
Olfr1437 T C 19: 12,322,668 D53G probably damaging Het
Olfr1490 C T 19: 13,655,247 P268S possibly damaging Het
Osbpl1a A G 18: 12,871,072 probably benign Het
Otud4 T A 8: 79,673,068 S803T probably benign Het
Pax9 C T 12: 56,709,744 T289I probably benign Het
Pcdha5 A C 18: 36,960,815 I126L possibly damaging Het
Psmd4 G T 3: 95,033,962 A55E probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rbm26 T A 14: 105,142,834 T516S probably benign Het
Sdr42e1 G A 8: 117,662,772 L377F probably damaging Het
Setdb1 T C 3: 95,327,201 probably benign Het
Uba3 T C 6: 97,203,553 E21G probably benign Het
Uggt2 C T 14: 119,019,507 S1105N probably benign Het
Zfp113 T C 5: 138,144,957 N344D probably benign Het
Zfp738 T C 13: 67,670,112 I587V probably benign Het
Other mutations in Igfbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Igfbp4 APN 11 99048243 missense probably damaging 0.99
R1865:Igfbp4 UTSW 11 99041686 missense probably damaging 1.00
R3824:Igfbp4 UTSW 11 99048235 missense probably damaging 1.00
R3825:Igfbp4 UTSW 11 99048235 missense probably damaging 1.00
R7815:Igfbp4 UTSW 11 99041828 missense probably benign 0.00
X0067:Igfbp4 UTSW 11 99048238 missense probably benign 0.26
Z1176:Igfbp4 UTSW 11 99051515 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAGCGTGCTTGCTAACTTCC -3'
(R):5'- AATGTACGCAGGGGCTTCTC -3'

Sequencing Primer
(F):5'- GCTTGCTAACTTCCCCGGC -3'
(R):5'- CGCATGCCTGAGCCACAG -3'
Posted On2015-01-23