Incidental Mutation 'R2907:Pax9'
ID261703
Institutional Source Beutler Lab
Gene Symbol Pax9
Ensembl Gene ENSMUSG00000001497
Gene Namepaired box 9
SynonymsPax-9
MMRRC Submission 040494-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R2907 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location56691767-56712822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 56709744 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 289 (T289I)
Ref Sequence ENSEMBL: ENSMUSP00000117928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001538] [ENSMUST00000044634] [ENSMUST00000110680] [ENSMUST00000153250] [ENSMUST00000217690]
Predicted Effect probably benign
Transcript: ENSMUST00000001538
AA Change: T289I

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000001538
Gene: ENSMUSG00000001497
AA Change: T289I

DomainStartEndE-ValueType
PAX 4 128 6.81e-90 SMART
low complexity region 265 274 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000044634
SMART Domains Protein: ENSMUSP00000039289
Gene: ENSMUSG00000035472

DomainStartEndE-ValueType
Pfam:Mito_carr 10 104 2.3e-24 PFAM
Pfam:Mito_carr 107 200 1.3e-16 PFAM
Pfam:Mito_carr 202 298 3.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110680
SMART Domains Protein: ENSMUSP00000106308
Gene: ENSMUSG00000035472

DomainStartEndE-ValueType
Pfam:Mito_carr 28 111 4.7e-21 PFAM
Pfam:Mito_carr 114 207 7.7e-17 PFAM
Pfam:Mito_carr 209 305 2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152848
Predicted Effect probably benign
Transcript: ENSMUST00000153250
AA Change: T289I

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000117928
Gene: ENSMUSG00000001497
AA Change: T289I

DomainStartEndE-ValueType
PAX 4 128 6.81e-90 SMART
low complexity region 265 274 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217690
Meta Mutation Damage Score 0.1201 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: This gene is a member of the paired box (PAX) family of transcription factors. Members of this gene family typically contain a paired box domain, an octapeptide, and a paired-type homeodomain. These genes play critical roles during fetal development and cancer growth. Mice lacking this gene exhibit impaired development of organs, musculature and the skeleton, including absent and abnormally developed teeth, and neonatal lethality. Mutations in the human gene are associated with selective tooth agenesis-3. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous inactivation of this gene results in abnormal tooth development and absent teeth and may lead to lack of pharyngeal pouch derivatives, athymia, craniofacial and limb anomalies, a small tympanic ring, various defects of the skeleton and musculature, and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,567,297 E385G probably damaging Het
Adam32 A T 8: 24,863,504 W690R probably damaging Het
Ap1b1 T A 11: 5,031,641 N516K probably damaging Het
Arap3 G A 18: 37,990,527 P452L possibly damaging Het
Armcx6 A T X: 134,749,450 C211S probably damaging Het
Asns A G 6: 7,675,506 S499P probably benign Het
Aspn G T 13: 49,551,898 V79F probably damaging Het
Astn2 A G 4: 65,644,856 I844T possibly damaging Het
Asxl3 A T 18: 22,517,273 H773L possibly damaging Het
Atp7b G A 8: 22,011,554 T781I probably damaging Het
Bcl6 G A 16: 23,968,119 R641W probably damaging Het
Csmd3 T A 15: 48,011,053 I612F probably damaging Het
Dnm1l A T 16: 16,314,311 S666T probably damaging Het
Gucy2c A T 6: 136,708,387 V852E probably damaging Het
H2-T3 G A 17: 36,187,455 R233C possibly damaging Het
Igfbp4 A G 11: 99,041,551 probably benign Het
Igkv16-104 T C 6: 68,425,927 I68T probably damaging Het
Kansl1 T A 11: 104,424,460 S251C possibly damaging Het
Kcnk1 G T 8: 125,995,799 V114L probably benign Het
Klra3 G T 6: 130,333,339 Q73K probably damaging Het
Mcpt1 T C 14: 56,020,123 V242A probably damaging Het
Nek10 C A 14: 14,980,613 Q990K possibly damaging Het
Nlrp4d A T 7: 10,378,427 V605E probably benign Het
Olfr1176 T C 2: 88,340,483 I306T probably benign Het
Olfr1437 T C 19: 12,322,668 D53G probably damaging Het
Olfr1490 C T 19: 13,655,247 P268S possibly damaging Het
Osbpl1a A G 18: 12,871,072 probably benign Het
Otud4 T A 8: 79,673,068 S803T probably benign Het
Pcdha5 A C 18: 36,960,815 I126L possibly damaging Het
Psmd4 G T 3: 95,033,962 A55E probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rbm26 T A 14: 105,142,834 T516S probably benign Het
Sdr42e1 G A 8: 117,662,772 L377F probably damaging Het
Setdb1 T C 3: 95,327,201 probably benign Het
Uba3 T C 6: 97,203,553 E21G probably benign Het
Uggt2 C T 14: 119,019,507 S1105N probably benign Het
Zfp113 T C 5: 138,144,957 N344D probably benign Het
Zfp738 T C 13: 67,670,112 I587V probably benign Het
Other mutations in Pax9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Pax9 APN 12 56700075 missense probably benign
IGL02724:Pax9 APN 12 56709819 missense possibly damaging 0.76
R0008:Pax9 UTSW 12 56709743 missense probably benign
R0008:Pax9 UTSW 12 56709743 missense probably benign
R1836:Pax9 UTSW 12 56700054 missense probably benign 0.03
R1916:Pax9 UTSW 12 56697138 missense possibly damaging 0.60
R3778:Pax9 UTSW 12 56696748 missense probably damaging 1.00
R4905:Pax9 UTSW 12 56696626 missense probably damaging 1.00
R6247:Pax9 UTSW 12 56709695 missense probably benign
R6469:Pax9 UTSW 12 56696863 missense probably damaging 1.00
R6693:Pax9 UTSW 12 56709731 missense probably benign 0.08
R7343:Pax9 UTSW 12 56695862 start codon destroyed probably null 0.48
R7739:Pax9 UTSW 12 56700099 missense probably benign 0.00
R7807:Pax9 UTSW 12 56697065 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAGGCTACCCTTAGGTCAAAG -3'
(R):5'- TCCCATCAGAGTGCAGAAGC -3'

Sequencing Primer
(F):5'- AGGGCTGTTAACTCCCTCAG -3'
(R):5'- TCAGAGTGCAGAAGCGGTCAC -3'
Posted On2015-01-23