Mutagenetix > Incidental Mutations

Incidental Mutation 'R2907:Zfp738'

261705

Institutional Source

Beutler Lab

Gene Symbol

Zfp738

Ensembl Gene

ENSMUSG00000048280

Gene Name

zinc finger protein 738

Synonyms

6720487G11Rik, 3830402I07Rik

MMRRC Submission

040494-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.075) question?

Stock #

R2907 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

67658685-67687071 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 67670112 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 587 (I587V)

Ref Sequence

ENSEMBL: ENSMUSP00000121275 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110973] [ENSMUST00000125495] [ENSMUST00000137496] [ENSMUST00000175678] [ENSMUST00000175821]

Predicted Effect

probably benign
Transcript: ENSMUST00000110973

SMART Domains

Protein: ENSMUSP00000106600
Gene: ENSMUSG00000048280

Domain	Start	End	E-Value	Type
KRAB	2	62	1.97e-31	SMART
SCOP:d1fgja_	76	119	1e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000125495

SMART Domains

Protein: ENSMUSP00000135683
Gene: ENSMUSG00000048280

Domain	Start	End	E-Value	Type
KRAB	5	65	1.97e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000137496
AA Change: I587V

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000121275
Gene: ENSMUSG00000048280
AA Change: I587V

Domain	Start	End	E-Value	Type
KRAB	15	75	1.97e-31	SMART
ZnF_C2H2	91	111	3.13e1	SMART
ZnF_C2H2	119	141	9.56e1	SMART
ZnF_C2H2	147	169	3.58e-2	SMART
ZnF_C2H2	175	197	3.21e-4	SMART
ZnF_C2H2	203	225	6.78e-3	SMART
ZnF_C2H2	231	253	8.34e-3	SMART
ZnF_C2H2	259	281	6.67e-2	SMART
ZnF_C2H2	287	309	1.12e-3	SMART
ZnF_C2H2	315	337	3.83e-2	SMART
ZnF_C2H2	343	365	8.34e-3	SMART
ZnF_C2H2	371	393	4.87e-4	SMART
ZnF_C2H2	427	449	9.58e-3	SMART
ZnF_C2H2	455	477	1.38e-3	SMART
ZnF_C2H2	483	505	3.89e-3	SMART
ZnF_C2H2	511	533	7.49e-5	SMART
ZnF_C2H2	539	561	5.5e-3	SMART
ZnF_C2H2	567	589	5.42e-2	SMART
ZnF_C2H2	595	617	7.78e-3	SMART
ZnF_C2H2	623	645	2.05e-2	SMART
ZnF_C2H2	651	673	2.57e-3	SMART
ZnF_C2H2	679	701	7.26e-3	SMART
ZnF_C2H2	735	757	5.42e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000175678

SMART Domains

Protein: ENSMUSP00000134865
Gene: ENSMUSG00000048280

Domain	Start	End	E-Value	Type
KRAB	15	75	1.97e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000175821

SMART Domains

Protein: ENSMUSP00000135050
Gene: ENSMUSG00000048280

Domain	Start	End	E-Value	Type
KRAB	5	65	1.97e-31	SMART
ZnF_C2H2	81	101	3.13e1	SMART
ZnF_C2H2	109	131	9.56e1	SMART
ZnF_C2H2	137	159	3.58e-2	SMART
ZnF_C2H2	165	187	3.21e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225507

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

97% (37/38)

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl6b	A	G	5: 137,567,297	E385G	probably damaging	Het
Adam32	A	T	8: 24,863,504	W690R	probably damaging	Het
Ap1b1	T	A	11: 5,031,641	N516K	probably damaging	Het
Arap3	G	A	18: 37,990,527	P452L	possibly damaging	Het
Armcx6	A	T	X: 134,749,450	C211S	probably damaging	Het
Asns	A	G	6: 7,675,506	S499P	probably benign	Het
Aspn	G	T	13: 49,551,898	V79F	probably damaging	Het
Astn2	A	G	4: 65,644,856	I844T	possibly damaging	Het
Asxl3	A	T	18: 22,517,273	H773L	possibly damaging	Het
Atp7b	G	A	8: 22,011,554	T781I	probably damaging	Het
Bcl6	G	A	16: 23,968,119	R641W	probably damaging	Het
Csmd3	T	A	15: 48,011,053	I612F	probably damaging	Het
Dnm1l	A	T	16: 16,314,311	S666T	probably damaging	Het
Gucy2c	A	T	6: 136,708,387	V852E	probably damaging	Het
H2-T3	G	A	17: 36,187,455	R233C	possibly damaging	Het
Igfbp4	A	G	11: 99,041,551		probably benign	Het
Igkv16-104	T	C	6: 68,425,927	I68T	probably damaging	Het
Kansl1	T	A	11: 104,424,460	S251C	possibly damaging	Het
Kcnk1	G	T	8: 125,995,799	V114L	probably benign	Het
Klra3	G	T	6: 130,333,339	Q73K	probably damaging	Het
Mcpt1	T	C	14: 56,020,123	V242A	probably damaging	Het
Nek10	C	A	14: 14,980,613	Q990K	possibly damaging	Het
Nlrp4d	A	T	7: 10,378,427	V605E	probably benign	Het
Olfr1176	T	C	2: 88,340,483	I306T	probably benign	Het
Olfr1437	T	C	19: 12,322,668	D53G	probably damaging	Het
Olfr1490	C	T	19: 13,655,247	P268S	possibly damaging	Het
Osbpl1a	A	G	18: 12,871,072		probably benign	Het
Otud4	T	A	8: 79,673,068	S803T	probably benign	Het
Pax9	C	T	12: 56,709,744	T289I	probably benign	Het
Pcdha5	A	C	18: 36,960,815	I126L	possibly damaging	Het
Psmd4	G	T	3: 95,033,962	A55E	probably damaging	Het
Rab36	G	A	10: 75,044,496	V63I	probably damaging	Het
Rbm26	T	A	14: 105,142,834	T516S	probably benign	Het
Sdr42e1	G	A	8: 117,662,772	L377F	probably damaging	Het
Setdb1	T	C	3: 95,327,201		probably benign	Het
Uba3	T	C	6: 97,203,553	E21G	probably benign	Het
Uggt2	C	T	14: 119,019,507	S1105N	probably benign	Het
Zfp113	T	C	5: 138,144,957	N344D	probably benign	Het

Other mutations in Zfp738

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01511:Zfp738	APN	13	67683401	critical splice donor site	probably null
IGL01734:Zfp738	APN	13	67683444	utr 5 prime	probably benign
IGL01980:Zfp738	APN	13	67669977	missense	possibly damaging	0.80
IGL02052:Zfp738	APN	13	67671481	missense	possibly damaging	0.87
IGL02330:Zfp738	APN	13	67671431	missense	probably damaging	0.99
IGL02686:Zfp738	APN	13	67673652	missense	probably damaging	1.00
I2505:Zfp738	UTSW	13	67673067	missense	probably benign	0.36
R0219:Zfp738	UTSW	13	67683389	intron	probably benign
R0491:Zfp738	UTSW	13	67670021	missense	possibly damaging	0.87
R0722:Zfp738	UTSW	13	67671524	missense	probably benign	0.09
R1116:Zfp738	UTSW	13	67670243	splice site	probably null
R1425:Zfp738	UTSW	13	67670775	missense	possibly damaging	0.77
R1854:Zfp738	UTSW	13	67670357	missense	probably damaging	1.00
R2095:Zfp738	UTSW	13	67671303	missense	probably damaging	1.00
R2171:Zfp738	UTSW	13	67670977	nonsense	probably null
R2180:Zfp738	UTSW	13	67671194	missense	probably damaging	1.00
R2225:Zfp738	UTSW	13	67670312	missense	probably damaging	1.00
R2226:Zfp738	UTSW	13	67670312	missense	probably damaging	1.00
R3605:Zfp738	UTSW	13	67671389	nonsense	probably null
R4731:Zfp738	UTSW	13	67669914	missense	probably damaging	1.00
R5037:Zfp738	UTSW	13	67670201	missense	probably damaging	1.00
R5223:Zfp738	UTSW	13	67673063	missense	probably damaging	0.99
R5259:Zfp738	UTSW	13	67669686	missense	probably benign
R5358:Zfp738	UTSW	13	67671012	missense	probably damaging	0.98
R6404:Zfp738	UTSW	13	67671060	missense	possibly damaging	0.89
R6874:Zfp738	UTSW	13	67670263	missense	possibly damaging	0.93
R7041:Zfp738	UTSW	13	67670301	missense	probably damaging	1.00
R7172:Zfp738	UTSW	13	67670408	missense	probably damaging	1.00
R7178:Zfp738	UTSW	13	67673028	missense	probably damaging	1.00
R7308:Zfp738	UTSW	13	67669553	missense	probably benign	0.00
R7386:Zfp738	UTSW	13	67670250	missense	probably damaging	1.00
R7453:Zfp738	UTSW	13	67670355	missense	probably benign	0.42
R7456:Zfp738	UTSW	13	67669500	missense	probably damaging	1.00
R7467:Zfp738	UTSW	13	67672961	missense	probably benign	0.03
R7615:Zfp738	UTSW	13	67670203	missense	probably damaging	0.96
R7663:Zfp738	UTSW	13	67683401	critical splice donor site	probably null
R7752:Zfp738	UTSW	13	67672991	nonsense	probably null
R7901:Zfp738	UTSW	13	67672991	nonsense	probably null
R8042:Zfp738	UTSW	13	67670891	missense	probably damaging	0.98
R8288:Zfp738	UTSW	13	67670789	missense	possibly damaging	0.88
R8340:Zfp738	UTSW	13	67671112	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGGAACATGGAACGCCTG -3'
(R):5'- AAGGCCTTCCGCTCTCTGTC -3'

Sequencing Primer
(F):5'- CTGGCCACATATGTCAGACTTGTAG -3'
(R):5'- TGTCCTCACTTTCTAAACACAAGAG -3'

Posted On

2015-01-23