Incidental Mutation 'R2907:Zfp738'
ID261705
Institutional Source Beutler Lab
Gene Symbol Zfp738
Ensembl Gene ENSMUSG00000048280
Gene Namezinc finger protein 738
Synonyms6720487G11Rik, 3830402I07Rik
MMRRC Submission 040494-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R2907 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location67658685-67687071 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67670112 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 587 (I587V)
Ref Sequence ENSEMBL: ENSMUSP00000121275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110973] [ENSMUST00000125495] [ENSMUST00000137496] [ENSMUST00000175678] [ENSMUST00000175821]
Predicted Effect probably benign
Transcript: ENSMUST00000110973
SMART Domains Protein: ENSMUSP00000106600
Gene: ENSMUSG00000048280

DomainStartEndE-ValueType
KRAB 2 62 1.97e-31 SMART
SCOP:d1fgja_ 76 119 1e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125495
SMART Domains Protein: ENSMUSP00000135683
Gene: ENSMUSG00000048280

DomainStartEndE-ValueType
KRAB 5 65 1.97e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137496
AA Change: I587V

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000121275
Gene: ENSMUSG00000048280
AA Change: I587V

DomainStartEndE-ValueType
KRAB 15 75 1.97e-31 SMART
ZnF_C2H2 91 111 3.13e1 SMART
ZnF_C2H2 119 141 9.56e1 SMART
ZnF_C2H2 147 169 3.58e-2 SMART
ZnF_C2H2 175 197 3.21e-4 SMART
ZnF_C2H2 203 225 6.78e-3 SMART
ZnF_C2H2 231 253 8.34e-3 SMART
ZnF_C2H2 259 281 6.67e-2 SMART
ZnF_C2H2 287 309 1.12e-3 SMART
ZnF_C2H2 315 337 3.83e-2 SMART
ZnF_C2H2 343 365 8.34e-3 SMART
ZnF_C2H2 371 393 4.87e-4 SMART
ZnF_C2H2 427 449 9.58e-3 SMART
ZnF_C2H2 455 477 1.38e-3 SMART
ZnF_C2H2 483 505 3.89e-3 SMART
ZnF_C2H2 511 533 7.49e-5 SMART
ZnF_C2H2 539 561 5.5e-3 SMART
ZnF_C2H2 567 589 5.42e-2 SMART
ZnF_C2H2 595 617 7.78e-3 SMART
ZnF_C2H2 623 645 2.05e-2 SMART
ZnF_C2H2 651 673 2.57e-3 SMART
ZnF_C2H2 679 701 7.26e-3 SMART
ZnF_C2H2 735 757 5.42e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175678
SMART Domains Protein: ENSMUSP00000134865
Gene: ENSMUSG00000048280

DomainStartEndE-ValueType
KRAB 15 75 1.97e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175821
SMART Domains Protein: ENSMUSP00000135050
Gene: ENSMUSG00000048280

DomainStartEndE-ValueType
KRAB 5 65 1.97e-31 SMART
ZnF_C2H2 81 101 3.13e1 SMART
ZnF_C2H2 109 131 9.56e1 SMART
ZnF_C2H2 137 159 3.58e-2 SMART
ZnF_C2H2 165 187 3.21e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225507
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,567,297 E385G probably damaging Het
Adam32 A T 8: 24,863,504 W690R probably damaging Het
Ap1b1 T A 11: 5,031,641 N516K probably damaging Het
Arap3 G A 18: 37,990,527 P452L possibly damaging Het
Armcx6 A T X: 134,749,450 C211S probably damaging Het
Asns A G 6: 7,675,506 S499P probably benign Het
Aspn G T 13: 49,551,898 V79F probably damaging Het
Astn2 A G 4: 65,644,856 I844T possibly damaging Het
Asxl3 A T 18: 22,517,273 H773L possibly damaging Het
Atp7b G A 8: 22,011,554 T781I probably damaging Het
Bcl6 G A 16: 23,968,119 R641W probably damaging Het
Csmd3 T A 15: 48,011,053 I612F probably damaging Het
Dnm1l A T 16: 16,314,311 S666T probably damaging Het
Gucy2c A T 6: 136,708,387 V852E probably damaging Het
H2-T3 G A 17: 36,187,455 R233C possibly damaging Het
Igfbp4 A G 11: 99,041,551 probably benign Het
Igkv16-104 T C 6: 68,425,927 I68T probably damaging Het
Kansl1 T A 11: 104,424,460 S251C possibly damaging Het
Kcnk1 G T 8: 125,995,799 V114L probably benign Het
Klra3 G T 6: 130,333,339 Q73K probably damaging Het
Mcpt1 T C 14: 56,020,123 V242A probably damaging Het
Nek10 C A 14: 14,980,613 Q990K possibly damaging Het
Nlrp4d A T 7: 10,378,427 V605E probably benign Het
Olfr1176 T C 2: 88,340,483 I306T probably benign Het
Olfr1437 T C 19: 12,322,668 D53G probably damaging Het
Olfr1490 C T 19: 13,655,247 P268S possibly damaging Het
Osbpl1a A G 18: 12,871,072 probably benign Het
Otud4 T A 8: 79,673,068 S803T probably benign Het
Pax9 C T 12: 56,709,744 T289I probably benign Het
Pcdha5 A C 18: 36,960,815 I126L possibly damaging Het
Psmd4 G T 3: 95,033,962 A55E probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rbm26 T A 14: 105,142,834 T516S probably benign Het
Sdr42e1 G A 8: 117,662,772 L377F probably damaging Het
Setdb1 T C 3: 95,327,201 probably benign Het
Uba3 T C 6: 97,203,553 E21G probably benign Het
Uggt2 C T 14: 119,019,507 S1105N probably benign Het
Zfp113 T C 5: 138,144,957 N344D probably benign Het
Other mutations in Zfp738
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Zfp738 APN 13 67683401 critical splice donor site probably null
IGL01734:Zfp738 APN 13 67683444 utr 5 prime probably benign
IGL01980:Zfp738 APN 13 67669977 missense possibly damaging 0.80
IGL02052:Zfp738 APN 13 67671481 missense possibly damaging 0.87
IGL02330:Zfp738 APN 13 67671431 missense probably damaging 0.99
IGL02686:Zfp738 APN 13 67673652 missense probably damaging 1.00
I2505:Zfp738 UTSW 13 67673067 missense probably benign 0.36
R0219:Zfp738 UTSW 13 67683389 intron probably benign
R0491:Zfp738 UTSW 13 67670021 missense possibly damaging 0.87
R0722:Zfp738 UTSW 13 67671524 missense probably benign 0.09
R1116:Zfp738 UTSW 13 67670243 unclassified probably null
R1425:Zfp738 UTSW 13 67670775 missense possibly damaging 0.77
R1854:Zfp738 UTSW 13 67670357 missense probably damaging 1.00
R2095:Zfp738 UTSW 13 67671303 missense probably damaging 1.00
R2171:Zfp738 UTSW 13 67670977 nonsense probably null
R2180:Zfp738 UTSW 13 67671194 missense probably damaging 1.00
R2225:Zfp738 UTSW 13 67670312 missense probably damaging 1.00
R2226:Zfp738 UTSW 13 67670312 missense probably damaging 1.00
R3605:Zfp738 UTSW 13 67671389 nonsense probably null
R4731:Zfp738 UTSW 13 67669914 missense probably damaging 1.00
R5037:Zfp738 UTSW 13 67670201 missense probably damaging 1.00
R5223:Zfp738 UTSW 13 67673063 missense probably damaging 0.99
R5259:Zfp738 UTSW 13 67669686 missense probably benign
R5358:Zfp738 UTSW 13 67671012 missense probably damaging 0.98
R6404:Zfp738 UTSW 13 67671060 missense possibly damaging 0.89
R6874:Zfp738 UTSW 13 67670263 missense possibly damaging 0.93
R7041:Zfp738 UTSW 13 67670301 missense probably damaging 1.00
R7172:Zfp738 UTSW 13 67670408 missense probably damaging 1.00
R7178:Zfp738 UTSW 13 67673028 missense probably damaging 1.00
R7308:Zfp738 UTSW 13 67669553 missense probably benign 0.00
R7386:Zfp738 UTSW 13 67670250 missense probably damaging 1.00
R7453:Zfp738 UTSW 13 67670355 missense probably benign 0.42
R7456:Zfp738 UTSW 13 67669500 missense probably damaging 1.00
R7467:Zfp738 UTSW 13 67672961 missense probably benign 0.03
R7615:Zfp738 UTSW 13 67670203 missense probably damaging 0.96
R7663:Zfp738 UTSW 13 67683401 critical splice donor site probably null
R7752:Zfp738 UTSW 13 67672991 nonsense probably null
R7901:Zfp738 UTSW 13 67672991 nonsense probably null
R7984:Zfp738 UTSW 13 67672991 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGAACATGGAACGCCTG -3'
(R):5'- AAGGCCTTCCGCTCTCTGTC -3'

Sequencing Primer
(F):5'- CTGGCCACATATGTCAGACTTGTAG -3'
(R):5'- TGTCCTCACTTTCTAAACACAAGAG -3'
Posted On2015-01-23