Incidental Mutation 'R2907:H2-T3'
ID261713
Institutional Source Beutler Lab
Gene Symbol H2-T3
Ensembl Gene ENSMUSG00000054128
Gene Namehistocompatibility 2, T region locus 3
SynonymsTL, H2-Tw3, H-2T3
MMRRC Submission 040494-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2907 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location36185572-36190287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36187455 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 233 (R233C)
Ref Sequence ENSEMBL: ENSMUSP00000134469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025312] [ENSMUST00000095300] [ENSMUST00000097329] [ENSMUST00000102675] [ENSMUST00000172663] [ENSMUST00000173133] [ENSMUST00000173629] [ENSMUST00000174101]
Predicted Effect probably benign
Transcript: ENSMUST00000025312
AA Change: R189C

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000025312
Gene: ENSMUSG00000054128
AA Change: R189C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:MHC_I 27 120 2.5e-40 PFAM
Pfam:MHC_I 114 161 3.7e-14 PFAM
IGc1 180 251 1.6e-20 SMART
transmembrane domain 271 290 N/A INTRINSIC
low complexity region 293 301 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095300
Predicted Effect probably benign
Transcript: ENSMUST00000097329
SMART Domains Protein: ENSMUSP00000138177
Gene: ENSMUSG00000054128

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102675
AA Change: R233C

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099736
Gene: ENSMUSG00000054128
AA Change: R233C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:MHC_I 27 205 9.3e-85 PFAM
IGc1 224 295 1.6e-20 SMART
transmembrane domain 315 334 N/A INTRINSIC
low complexity region 337 345 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172663
SMART Domains Protein: ENSMUSP00000134547
Gene: ENSMUSG00000054128

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:MHC_I 25 203 5.1e-85 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173133
AA Change: R233C

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134469
Gene: ENSMUSG00000054128
AA Change: R233C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:MHC_I 27 205 2.6e-84 PFAM
IGc1 224 295 1.6e-20 SMART
transmembrane domain 315 334 N/A INTRINSIC
low complexity region 337 345 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173577
Predicted Effect probably benign
Transcript: ENSMUST00000173629
SMART Domains Protein: ENSMUSP00000134607
Gene: ENSMUSG00000054128

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:MHC_I 25 119 1.4e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174101
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (37/38)
MGI Phenotype PHENOTYPE: This locus contains the sole gene encoding the thymic leukemia antigen or TL antigen in "b haplotype" mice such as C57BL/6. Mice homozygous for a targeted knock-out are viable with normal reproduction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,567,297 E385G probably damaging Het
Adam32 A T 8: 24,863,504 W690R probably damaging Het
Ap1b1 T A 11: 5,031,641 N516K probably damaging Het
Arap3 G A 18: 37,990,527 P452L possibly damaging Het
Armcx6 A T X: 134,749,450 C211S probably damaging Het
Asns A G 6: 7,675,506 S499P probably benign Het
Aspn G T 13: 49,551,898 V79F probably damaging Het
Astn2 A G 4: 65,644,856 I844T possibly damaging Het
Asxl3 A T 18: 22,517,273 H773L possibly damaging Het
Atp7b G A 8: 22,011,554 T781I probably damaging Het
Bcl6 G A 16: 23,968,119 R641W probably damaging Het
Csmd3 T A 15: 48,011,053 I612F probably damaging Het
Dnm1l A T 16: 16,314,311 S666T probably damaging Het
Gucy2c A T 6: 136,708,387 V852E probably damaging Het
Igfbp4 A G 11: 99,041,551 probably benign Het
Igkv16-104 T C 6: 68,425,927 I68T probably damaging Het
Kansl1 T A 11: 104,424,460 S251C possibly damaging Het
Kcnk1 G T 8: 125,995,799 V114L probably benign Het
Klra3 G T 6: 130,333,339 Q73K probably damaging Het
Mcpt1 T C 14: 56,020,123 V242A probably damaging Het
Nek10 C A 14: 14,980,613 Q990K possibly damaging Het
Nlrp4d A T 7: 10,378,427 V605E probably benign Het
Olfr1176 T C 2: 88,340,483 I306T probably benign Het
Olfr1437 T C 19: 12,322,668 D53G probably damaging Het
Olfr1490 C T 19: 13,655,247 P268S possibly damaging Het
Osbpl1a A G 18: 12,871,072 probably benign Het
Otud4 T A 8: 79,673,068 S803T probably benign Het
Pax9 C T 12: 56,709,744 T289I probably benign Het
Pcdha5 A C 18: 36,960,815 I126L possibly damaging Het
Psmd4 G T 3: 95,033,962 A55E probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rbm26 T A 14: 105,142,834 T516S probably benign Het
Sdr42e1 G A 8: 117,662,772 L377F probably damaging Het
Setdb1 T C 3: 95,327,201 probably benign Het
Uba3 T C 6: 97,203,553 E21G probably benign Het
Uggt2 C T 14: 119,019,507 S1105N probably benign Het
Zfp113 T C 5: 138,144,957 N344D probably benign Het
Zfp738 T C 13: 67,670,112 I587V probably benign Het
Other mutations in H2-T3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:H2-T3 APN 17 36187041 missense probably benign
IGL01922:H2-T3 APN 17 36187100 missense possibly damaging 0.53
IGL02389:H2-T3 APN 17 36186608 missense probably benign 0.01
IGL02423:H2-T3 APN 17 36187356 missense probably damaging 0.98
IGL02963:H2-T3 APN 17 36189634 missense probably damaging 0.98
IGL03298:H2-T3 APN 17 36189428 missense probably damaging 1.00
R1479:H2-T3 UTSW 17 36189428 missense probably damaging 1.00
R3623:H2-T3 UTSW 17 36190065 missense possibly damaging 0.91
R3624:H2-T3 UTSW 17 36190065 missense possibly damaging 0.91
R3779:H2-T3 UTSW 17 36189682 missense probably damaging 0.99
R4271:H2-T3 UTSW 17 36189618 missense probably damaging 1.00
R4586:H2-T3 UTSW 17 36189344 intron probably null
R5351:H2-T3 UTSW 17 36190073 missense probably benign 0.06
R5387:H2-T3 UTSW 17 36186702 missense probably benign 0.00
R5474:H2-T3 UTSW 17 36190107 missense probably damaging 0.99
R5711:H2-T3 UTSW 17 36187409 missense probably damaging 1.00
R6458:H2-T3 UTSW 17 36187019 missense possibly damaging 0.53
R6849:H2-T3 UTSW 17 36189805 missense probably benign 0.32
R6956:H2-T3 UTSW 17 36189371 missense probably damaging 1.00
R6993:H2-T3 UTSW 17 36187070 missense probably damaging 0.99
R7336:H2-T3 UTSW 17 36187345 missense probably damaging 1.00
R7414:H2-T3 UTSW 17 36187383 missense not run
RF009:H2-T3 UTSW 17 36189402 intron probably benign
Predicted Primers PCR Primer
(F):5'- TGAGGGTCTTCAGAAGGCTC -3'
(R):5'- GGAAATTTGACCCTTGTTCCAGTC -3'

Sequencing Primer
(F):5'- AAGGCTCCAGCTTTCCCTGAC -3'
(R):5'- AGTCATTTCCTTCCCAGGTGG -3'
Posted On2015-01-23