Incidental Mutation 'R2907:Arap3'
ID261716
Institutional Source Beutler Lab
Gene Symbol Arap3
Ensembl Gene ENSMUSG00000024451
Gene NameArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3
SynonymsDRAG1, E030006K04Rik, Centd3
MMRRC Submission 040494-MU
Accession Numbers

NCBI RefSeq: NM_139206.2, NM_001205336.1; MGI:2147274

Is this an essential gene? Probably essential (E-score: 0.773) question?
Stock #R2907 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37972624-37997574 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37990527 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 452 (P452L)
Ref Sequence ENSEMBL: ENSMUSP00000035662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042944]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042944
AA Change: P452L

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000035662
Gene: ENSMUSG00000024451
AA Change: P452L

DomainStartEndE-ValueType
SAM 1 68 1.5e-7 SMART
low complexity region 81 98 N/A INTRINSIC
low complexity region 134 142 N/A INTRINSIC
PH 283 376 3.4e-16 SMART
PH 390 480 1.61e-8 SMART
ArfGap 484 606 1.44e-25 SMART
low complexity region 642 661 N/A INTRINSIC
PH 671 785 2.86e1 SMART
PH 795 901 6.87e-3 SMART
RhoGAP 913 1089 2.11e-47 SMART
Pfam:RA 1113 1206 6.2e-16 PFAM
PH 1220 1323 3.46e-8 SMART
low complexity region 1388 1407 N/A INTRINSIC
low complexity region 1457 1469 N/A INTRINSIC
low complexity region 1475 1486 N/A INTRINSIC
low complexity region 1494 1529 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185063
Meta Mutation Damage Score 0.5607 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (37/38)
MGI Phenotype Strain: 5428754
Lethality: E10-E11
FUNCTION: This gene encodes a phosphoinositide binding protein containing ARF-GAP, RHO-GAP, RAS-associating, and pleckstrin homology domains. The ARF-GAP and RHO-GAP domains cooperate in mediating rearrangements in the cell cytoskeleton and cell shape. It is a specific PtdIns(3,4,5)P3/PtdIns(3,4)P2-stimulated Arf6-GAP protein. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele die around E11 exhibiting pallor, embryonic growth arrest, yolk sac and placental abnormalities, and an endothelial cell-autonomous defect in sprouting angiogenesis. Knock-in mice homozygous for a point mutation display similar angiogenesis defects. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,567,297 E385G probably damaging Het
Adam32 A T 8: 24,863,504 W690R probably damaging Het
Ap1b1 T A 11: 5,031,641 N516K probably damaging Het
Armcx6 A T X: 134,749,450 C211S probably damaging Het
Asns A G 6: 7,675,506 S499P probably benign Het
Aspn G T 13: 49,551,898 V79F probably damaging Het
Astn2 A G 4: 65,644,856 I844T possibly damaging Het
Asxl3 A T 18: 22,517,273 H773L possibly damaging Het
Atp7b G A 8: 22,011,554 T781I probably damaging Het
Bcl6 G A 16: 23,968,119 R641W probably damaging Het
Csmd3 T A 15: 48,011,053 I612F probably damaging Het
Dnm1l A T 16: 16,314,311 S666T probably damaging Het
Gucy2c A T 6: 136,708,387 V852E probably damaging Het
H2-T3 G A 17: 36,187,455 R233C possibly damaging Het
Igfbp4 A G 11: 99,041,551 probably benign Het
Igkv16-104 T C 6: 68,425,927 I68T probably damaging Het
Kansl1 T A 11: 104,424,460 S251C possibly damaging Het
Kcnk1 G T 8: 125,995,799 V114L probably benign Het
Klra3 G T 6: 130,333,339 Q73K probably damaging Het
Mcpt1 T C 14: 56,020,123 V242A probably damaging Het
Nek10 C A 14: 14,980,613 Q990K possibly damaging Het
Nlrp4d A T 7: 10,378,427 V605E probably benign Het
Olfr1176 T C 2: 88,340,483 I306T probably benign Het
Olfr1437 T C 19: 12,322,668 D53G probably damaging Het
Olfr1490 C T 19: 13,655,247 P268S possibly damaging Het
Osbpl1a A G 18: 12,871,072 probably benign Het
Otud4 T A 8: 79,673,068 S803T probably benign Het
Pax9 C T 12: 56,709,744 T289I probably benign Het
Pcdha5 A C 18: 36,960,815 I126L possibly damaging Het
Psmd4 G T 3: 95,033,962 A55E probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rbm26 T A 14: 105,142,834 T516S probably benign Het
Sdr42e1 G A 8: 117,662,772 L377F probably damaging Het
Setdb1 T C 3: 95,327,201 probably benign Het
Uba3 T C 6: 97,203,553 E21G probably benign Het
Uggt2 C T 14: 119,019,507 S1105N probably benign Het
Zfp113 T C 5: 138,144,957 N344D probably benign Het
Zfp738 T C 13: 67,670,112 I587V probably benign Het
Other mutations in Arap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Arap3 APN 18 37975926 missense probably damaging 1.00
IGL01145:Arap3 APN 18 37989179 missense probably benign
IGL01154:Arap3 APN 18 37996734 missense probably benign 0.28
IGL01305:Arap3 APN 18 37991327 critical splice donor site probably null
IGL01542:Arap3 APN 18 37990836 missense probably damaging 0.98
IGL01543:Arap3 APN 18 37990836 missense probably damaging 0.98
IGL01544:Arap3 APN 18 37990836 missense probably damaging 0.98
IGL01545:Arap3 APN 18 37990836 missense probably damaging 0.98
IGL01677:Arap3 APN 18 37996647 missense probably benign
IGL01925:Arap3 APN 18 37984246 missense probably benign 0.21
IGL01933:Arap3 APN 18 37978453 missense possibly damaging 0.65
IGL02048:Arap3 APN 18 37996979 missense possibly damaging 0.56
IGL02064:Arap3 APN 18 37991701 missense probably damaging 1.00
IGL02207:Arap3 APN 18 37987853 missense probably benign 0.00
IGL02376:Arap3 APN 18 37978453 missense possibly damaging 0.95
IGL02531:Arap3 APN 18 37989751 missense probably damaging 0.99
IGL02568:Arap3 APN 18 37996658 missense probably benign 0.32
IGL02640:Arap3 APN 18 37987802 missense possibly damaging 0.71
IGL02658:Arap3 APN 18 37990994 missense probably benign 0.09
IGL03090:Arap3 APN 18 37989112 missense probably benign 0.00
IGL03352:Arap3 APN 18 37981302 splice site probably benign
ANU22:Arap3 UTSW 18 37991327 critical splice donor site probably null
P0016:Arap3 UTSW 18 37984348 missense probably benign 0.00
PIT4260001:Arap3 UTSW 18 37996895 missense probably benign 0.08
R0066:Arap3 UTSW 18 37996707 missense probably benign 0.01
R0324:Arap3 UTSW 18 37973225 missense possibly damaging 0.93
R0562:Arap3 UTSW 18 37975540 missense probably damaging 1.00
R1289:Arap3 UTSW 18 37981973 missense possibly damaging 0.95
R1346:Arap3 UTSW 18 37975918 missense probably damaging 1.00
R1419:Arap3 UTSW 18 37978432 missense possibly damaging 0.51
R1470:Arap3 UTSW 18 37989196 critical splice acceptor site probably null
R1470:Arap3 UTSW 18 37989196 critical splice acceptor site probably null
R1537:Arap3 UTSW 18 37989684 critical splice donor site probably null
R1644:Arap3 UTSW 18 37984245 missense probably damaging 1.00
R1731:Arap3 UTSW 18 37989912 missense probably benign 0.01
R1758:Arap3 UTSW 18 37989912 missense probably benign 0.01
R1843:Arap3 UTSW 18 37975583 missense probably damaging 1.00
R1907:Arap3 UTSW 18 37996671 missense probably benign 0.28
R1954:Arap3 UTSW 18 37982002 missense probably damaging 1.00
R2124:Arap3 UTSW 18 37973350 missense probably damaging 0.98
R2135:Arap3 UTSW 18 37974456 missense probably damaging 1.00
R2172:Arap3 UTSW 18 37990560 missense probably damaging 1.00
R2418:Arap3 UTSW 18 37989944 missense probably damaging 1.00
R2419:Arap3 UTSW 18 37989944 missense probably damaging 1.00
R4425:Arap3 UTSW 18 37978600 missense probably damaging 1.00
R4669:Arap3 UTSW 18 37996254 missense probably benign 0.08
R4734:Arap3 UTSW 18 37996275 missense probably benign 0.00
R4815:Arap3 UTSW 18 37973243 missense probably benign
R5328:Arap3 UTSW 18 37991687 missense possibly damaging 0.92
R5350:Arap3 UTSW 18 37982035 missense probably damaging 1.00
R5466:Arap3 UTSW 18 37996736 missense probably benign 0.00
R5482:Arap3 UTSW 18 37974674 missense possibly damaging 0.95
R5572:Arap3 UTSW 18 37991066 missense probably damaging 1.00
R5779:Arap3 UTSW 18 37984365 missense probably damaging 1.00
R6053:Arap3 UTSW 18 37990771 missense probably damaging 0.98
R6144:Arap3 UTSW 18 37985433 missense probably damaging 0.98
R6166:Arap3 UTSW 18 37974370 missense probably damaging 1.00
R6248:Arap3 UTSW 18 37991354 missense probably benign 0.09
R6266:Arap3 UTSW 18 37990791 missense probably damaging 0.98
R6385:Arap3 UTSW 18 37997031 nonsense probably null
R6694:Arap3 UTSW 18 37991537 critical splice donor site probably null
R6856:Arap3 UTSW 18 37979863 missense possibly damaging 0.95
R7073:Arap3 UTSW 18 37974442 nonsense probably null
R7297:Arap3 UTSW 18 37973563 missense possibly damaging 0.81
R7352:Arap3 UTSW 18 37973278 missense probably benign 0.00
R7652:Arap3 UTSW 18 37978452 missense probably damaging 0.99
R7726:Arap3 UTSW 18 37989467 missense probably damaging 0.99
R7747:Arap3 UTSW 18 37988888 splice site probably null
R7944:Arap3 UTSW 18 37989179 missense probably benign
R8152:Arap3 UTSW 18 37991357 missense possibly damaging 0.61
R8338:Arap3 UTSW 18 37973630 missense probably damaging 0.99
R8549:Arap3 UTSW 18 37973312 missense probably benign 0.17
R8793:Arap3 UTSW 18 37974439 missense probably benign 0.04
X0011:Arap3 UTSW 18 37974101 critical splice donor site probably null
X0026:Arap3 UTSW 18 37985311 critical splice donor site probably null
X0027:Arap3 UTSW 18 37973485 splice site probably null
X0066:Arap3 UTSW 18 37991646 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAGCCAGTCCATAGGCATG -3'
(R):5'- GCTGGCACTGTACAAGAGTG -3'

Sequencing Primer
(F):5'- TGGGGATCAAACTCTAGCTGCATC -3'
(R):5'- TGGCACTGTACAAGAGTGAGCAG -3'
Posted On2015-01-23