Incidental Mutation 'R2907:Olfr1437'
ID261718
Institutional Source Beutler Lab
Gene Symbol Olfr1437
Ensembl Gene ENSMUSG00000096436
Gene Nameolfactory receptor 1437
SynonymsGA_x6K02T2RE5P-2658227-2657289, MOR214-6
MMRRC Submission 040494-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R2907 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12319207-12325101 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12322668 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 53 (D53G)
Ref Sequence ENSEMBL: ENSMUSP00000146333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052558] [ENSMUST00000207241]
Predicted Effect probably damaging
Transcript: ENSMUST00000052558
AA Change: D53G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000056003
Gene: ENSMUSG00000096436
AA Change: D53G

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 6.7e-55 PFAM
Pfam:7tm_1 42 291 5.6e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207241
AA Change: D53G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.5615 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,567,297 E385G probably damaging Het
Adam32 A T 8: 24,863,504 W690R probably damaging Het
Ap1b1 T A 11: 5,031,641 N516K probably damaging Het
Arap3 G A 18: 37,990,527 P452L possibly damaging Het
Armcx6 A T X: 134,749,450 C211S probably damaging Het
Asns A G 6: 7,675,506 S499P probably benign Het
Aspn G T 13: 49,551,898 V79F probably damaging Het
Astn2 A G 4: 65,644,856 I844T possibly damaging Het
Asxl3 A T 18: 22,517,273 H773L possibly damaging Het
Atp7b G A 8: 22,011,554 T781I probably damaging Het
Bcl6 G A 16: 23,968,119 R641W probably damaging Het
Csmd3 T A 15: 48,011,053 I612F probably damaging Het
Dnm1l A T 16: 16,314,311 S666T probably damaging Het
Gucy2c A T 6: 136,708,387 V852E probably damaging Het
H2-T3 G A 17: 36,187,455 R233C possibly damaging Het
Igfbp4 A G 11: 99,041,551 probably benign Het
Igkv16-104 T C 6: 68,425,927 I68T probably damaging Het
Kansl1 T A 11: 104,424,460 S251C possibly damaging Het
Kcnk1 G T 8: 125,995,799 V114L probably benign Het
Klra3 G T 6: 130,333,339 Q73K probably damaging Het
Mcpt1 T C 14: 56,020,123 V242A probably damaging Het
Nek10 C A 14: 14,980,613 Q990K possibly damaging Het
Nlrp4d A T 7: 10,378,427 V605E probably benign Het
Olfr1176 T C 2: 88,340,483 I306T probably benign Het
Olfr1490 C T 19: 13,655,247 P268S possibly damaging Het
Osbpl1a A G 18: 12,871,072 probably benign Het
Otud4 T A 8: 79,673,068 S803T probably benign Het
Pax9 C T 12: 56,709,744 T289I probably benign Het
Pcdha5 A C 18: 36,960,815 I126L possibly damaging Het
Psmd4 G T 3: 95,033,962 A55E probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rbm26 T A 14: 105,142,834 T516S probably benign Het
Sdr42e1 G A 8: 117,662,772 L377F probably damaging Het
Setdb1 T C 3: 95,327,201 probably benign Het
Uba3 T C 6: 97,203,553 E21G probably benign Het
Uggt2 C T 14: 119,019,507 S1105N probably benign Het
Zfp113 T C 5: 138,144,957 N344D probably benign Het
Zfp738 T C 13: 67,670,112 I587V probably benign Het
Other mutations in Olfr1437
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03034:Olfr1437 APN 19 12322654 missense possibly damaging 0.79
R0319:Olfr1437 UTSW 19 12322316 nonsense probably null
R1603:Olfr1437 UTSW 19 12321984 missense probably damaging 0.99
R2175:Olfr1437 UTSW 19 12322521 missense probably damaging 0.97
R5250:Olfr1437 UTSW 19 12322066 missense probably benign 0.01
R5390:Olfr1437 UTSW 19 12322141 missense probably damaging 0.98
R6949:Olfr1437 UTSW 19 12322428 missense probably damaging 1.00
R7437:Olfr1437 UTSW 19 12322108 missense probably damaging 0.99
R7652:Olfr1437 UTSW 19 12322287 missense probably damaging 1.00
Z1176:Olfr1437 UTSW 19 12322267
Predicted Primers PCR Primer
(F):5'- ACAAATGGCAGCATACCTGTC -3'
(R):5'- TCCCCAGTACTAACTAGGATTACC -3'

Sequencing Primer
(F):5'- GCTGTCATGAGGCAAGATTCACTC -3'
(R):5'- AGTACTAACTAGGATTACCAAGGC -3'
Posted On2015-01-23