Incidental Mutation 'R1786:Crocc'
ID 261725
Institutional Source Beutler Lab
Gene Symbol Crocc
Ensembl Gene ENSMUSG00000040860
Gene Name ciliary rootlet coiled-coil, rootletin
Synonyms
MMRRC Submission 039817-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.174) question?
Stock # R1786 (G1)
Quality Score 65
Status Validated
Chromosome 4
Chromosomal Location 140743948-140787861 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 140749113 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1564 (D1564G)
Ref Sequence ENSEMBL: ENSMUSP00000099549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040222] [ENSMUST00000097816] [ENSMUST00000102491] [ENSMUST00000168157]
AlphaFold Q8CJ40
Predicted Effect possibly damaging
Transcript: ENSMUST00000040222
AA Change: D1400G

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000037679
Gene: ENSMUSG00000040860
AA Change: D1400G

DomainStartEndE-ValueType
Pfam:Rootletin 1 173 6.1e-48 PFAM
low complexity region 190 217 N/A INTRINSIC
internal_repeat_2 298 315 1.08e-6 PROSPERO
low complexity region 329 350 N/A INTRINSIC
internal_repeat_3 363 393 5.38e-6 PROSPERO
internal_repeat_6 369 392 2.67e-5 PROSPERO
low complexity region 397 411 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 624 643 N/A INTRINSIC
low complexity region 699 716 N/A INTRINSIC
low complexity region 845 875 N/A INTRINSIC
internal_repeat_4 886 904 2.67e-5 PROSPERO
internal_repeat_7 893 906 5.96e-5 PROSPERO
internal_repeat_2 893 910 1.08e-6 PROSPERO
internal_repeat_4 897 914 2.67e-5 PROSPERO
internal_repeat_1 912 937 1.97e-8 PROSPERO
internal_repeat_7 1028 1041 5.96e-5 PROSPERO
low complexity region 1107 1124 N/A INTRINSIC
internal_repeat_5 1138 1164 2.67e-5 PROSPERO
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1253 1269 N/A INTRINSIC
low complexity region 1270 1289 N/A INTRINSIC
low complexity region 1297 1309 N/A INTRINSIC
internal_repeat_6 1533 1556 2.67e-5 PROSPERO
low complexity region 1559 1576 N/A INTRINSIC
coiled coil region 1580 1707 N/A INTRINSIC
coiled coil region 1728 1832 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097816
AA Change: D1400G

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095425
Gene: ENSMUSG00000040860
AA Change: D1400G

DomainStartEndE-ValueType
Pfam:Rootletin 1 173 6.1e-48 PFAM
low complexity region 190 217 N/A INTRINSIC
internal_repeat_2 298 315 1.08e-6 PROSPERO
low complexity region 329 350 N/A INTRINSIC
internal_repeat_3 363 393 5.38e-6 PROSPERO
internal_repeat_6 369 392 2.67e-5 PROSPERO
low complexity region 397 411 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 624 643 N/A INTRINSIC
low complexity region 699 716 N/A INTRINSIC
low complexity region 845 875 N/A INTRINSIC
internal_repeat_4 886 904 2.67e-5 PROSPERO
internal_repeat_7 893 906 5.96e-5 PROSPERO
internal_repeat_2 893 910 1.08e-6 PROSPERO
internal_repeat_4 897 914 2.67e-5 PROSPERO
internal_repeat_1 912 937 1.97e-8 PROSPERO
internal_repeat_7 1028 1041 5.96e-5 PROSPERO
low complexity region 1107 1124 N/A INTRINSIC
internal_repeat_5 1138 1164 2.67e-5 PROSPERO
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1253 1269 N/A INTRINSIC
low complexity region 1270 1289 N/A INTRINSIC
low complexity region 1297 1309 N/A INTRINSIC
internal_repeat_6 1533 1556 2.67e-5 PROSPERO
low complexity region 1559 1576 N/A INTRINSIC
coiled coil region 1580 1707 N/A INTRINSIC
coiled coil region 1728 1832 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102491
AA Change: D1564G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099549
Gene: ENSMUSG00000040860
AA Change: D1564G

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 77 93 N/A INTRINSIC
Pfam:Rootletin 158 336 9.7e-65 PFAM
low complexity region 354 381 N/A INTRINSIC
internal_repeat_2 462 479 1.77e-6 PROSPERO
low complexity region 493 514 N/A INTRINSIC
internal_repeat_3 527 557 8.63e-6 PROSPERO
internal_repeat_6 533 556 4.21e-5 PROSPERO
low complexity region 561 575 N/A INTRINSIC
low complexity region 576 594 N/A INTRINSIC
low complexity region 617 638 N/A INTRINSIC
low complexity region 788 807 N/A INTRINSIC
low complexity region 863 880 N/A INTRINSIC
low complexity region 1009 1039 N/A INTRINSIC
internal_repeat_4 1050 1068 4.21e-5 PROSPERO
internal_repeat_7 1057 1070 9.31e-5 PROSPERO
internal_repeat_2 1057 1074 1.77e-6 PROSPERO
internal_repeat_4 1061 1078 4.21e-5 PROSPERO
internal_repeat_1 1076 1101 3.36e-8 PROSPERO
internal_repeat_7 1192 1205 9.31e-5 PROSPERO
low complexity region 1271 1288 N/A INTRINSIC
internal_repeat_5 1302 1328 4.21e-5 PROSPERO
low complexity region 1354 1365 N/A INTRINSIC
low complexity region 1417 1433 N/A INTRINSIC
low complexity region 1434 1453 N/A INTRINSIC
low complexity region 1461 1473 N/A INTRINSIC
internal_repeat_6 1697 1720 4.21e-5 PROSPERO
low complexity region 1723 1740 N/A INTRINSIC
coiled coil region 1744 1871 N/A INTRINSIC
coiled coil region 1892 1996 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124286
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137721
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151455
Predicted Effect possibly damaging
Transcript: ENSMUST00000168157
AA Change: D1400G

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126543
Gene: ENSMUSG00000040860
AA Change: D1400G

DomainStartEndE-ValueType
Pfam:Rootletin 1 173 6.1e-48 PFAM
low complexity region 190 217 N/A INTRINSIC
internal_repeat_2 298 315 1.08e-6 PROSPERO
low complexity region 329 350 N/A INTRINSIC
internal_repeat_3 363 393 5.38e-6 PROSPERO
internal_repeat_6 369 392 2.67e-5 PROSPERO
low complexity region 397 411 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 624 643 N/A INTRINSIC
low complexity region 699 716 N/A INTRINSIC
low complexity region 845 875 N/A INTRINSIC
internal_repeat_4 886 904 2.67e-5 PROSPERO
internal_repeat_7 893 906 5.96e-5 PROSPERO
internal_repeat_2 893 910 1.08e-6 PROSPERO
internal_repeat_4 897 914 2.67e-5 PROSPERO
internal_repeat_1 912 937 1.97e-8 PROSPERO
internal_repeat_7 1028 1041 5.96e-5 PROSPERO
low complexity region 1107 1124 N/A INTRINSIC
internal_repeat_5 1138 1164 2.67e-5 PROSPERO
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1253 1269 N/A INTRINSIC
low complexity region 1270 1289 N/A INTRINSIC
low complexity region 1297 1309 N/A INTRINSIC
internal_repeat_6 1533 1556 2.67e-5 PROSPERO
low complexity region 1559 1576 N/A INTRINSIC
coiled coil region 1580 1707 N/A INTRINSIC
coiled coil region 1728 1832 N/A INTRINSIC
Meta Mutation Damage Score 0.1419 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 97% (98/101)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation show no apparent functional deficits in phototransduction and ciliary beating in sensory and motile cilia. However, photoreceptors degenerate over time, and lungs appear prone to pathological changes. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Gene trapped(3)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,553,223 (GRCm39) N178I probably damaging Het
Abcc4 G A 14: 118,790,761 (GRCm39) R749C probably damaging Het
Acot11 T C 4: 106,619,232 (GRCm39) E201G probably damaging Het
Akap13 G T 7: 75,261,182 (GRCm39) A1269S probably benign Het
Aldh4a1 T C 4: 139,371,439 (GRCm39) V451A probably benign Het
Aopep T A 13: 63,357,963 (GRCm39) C656S probably benign Het
Aox3 A G 1: 58,209,002 (GRCm39) H845R probably damaging Het
Asb6 G A 2: 30,717,088 (GRCm39) R46W probably damaging Het
Bpifb6 T C 2: 153,748,781 (GRCm39) F259S probably damaging Het
Cad T A 5: 31,215,416 (GRCm39) F76I probably damaging Het
Camk2b T C 11: 5,927,880 (GRCm39) E390G probably benign Het
Cars1 C A 7: 143,146,211 (GRCm39) R71M probably damaging Het
Ccdc170 T G 10: 4,469,043 (GRCm39) I197S probably benign Het
Ccn4 G A 15: 66,778,338 (GRCm39) C53Y probably damaging Het
Cdc20b A T 13: 113,217,668 (GRCm39) K362N probably damaging Het
Cntrl CAGAG CAG 2: 35,012,818 (GRCm39) probably null Het
Cpd T C 11: 76,683,624 (GRCm39) D1045G probably benign Het
Csf1r A T 18: 61,262,149 (GRCm39) M802L probably damaging Het
Dctn4 T C 18: 60,679,407 (GRCm39) probably null Het
Dnah5 A G 15: 28,313,932 (GRCm39) Q1916R probably damaging Het
Dpysl2 A G 14: 67,100,114 (GRCm39) probably benign Het
Dync2h1 A G 9: 7,081,084 (GRCm39) Y2871H probably damaging Het
Fam221b T A 4: 43,665,537 (GRCm39) H307L probably damaging Het
Foxn4 C T 5: 114,401,193 (GRCm39) D37N probably damaging Het
Gemin4 G C 11: 76,101,876 (GRCm39) P962A probably damaging Het
Gm9797 T C 10: 11,485,069 (GRCm39) noncoding transcript Het
Golim4 A T 3: 75,815,456 (GRCm39) V116D probably damaging Het
Gper1 C T 5: 139,412,477 (GRCm39) P274L probably damaging Het
Gpr132 A G 12: 112,816,023 (GRCm39) S268P probably damaging Het
Gtpbp2 T C 17: 46,472,128 (GRCm39) M21T probably benign Het
Hivep1 C T 13: 42,337,262 (GRCm39) A2447V possibly damaging Het
Ift20 G A 11: 78,430,860 (GRCm39) E68K probably damaging Het
Insrr G A 3: 87,717,879 (GRCm39) probably null Het
Kcnh8 T C 17: 53,200,961 (GRCm39) V465A probably damaging Het
Kif5c T A 2: 49,648,817 (GRCm39) probably benign Het
Kmt2a G A 9: 44,730,972 (GRCm39) probably benign Het
Lhx6 G T 2: 35,977,470 (GRCm39) C327* probably null Het
Lifr A G 15: 7,211,337 (GRCm39) D625G possibly damaging Het
Llgl1 T C 11: 60,598,066 (GRCm39) V370A probably benign Het
Lman1 A T 18: 66,124,653 (GRCm39) M362K probably damaging Het
Lmtk2 C T 5: 144,111,806 (GRCm39) T842I possibly damaging Het
Lpin3 T A 2: 160,738,729 (GRCm39) L227* probably null Het
Ltv1 C G 10: 13,058,280 (GRCm39) probably benign Het
Magel2 A T 7: 62,027,486 (GRCm39) H130L unknown Het
Mettl17 A T 14: 52,126,192 (GRCm39) probably benign Het
Mnx1 T A 5: 29,679,187 (GRCm39) S299C unknown Het
Mov10 A T 3: 104,725,432 (GRCm39) I59N possibly damaging Het
Myo7b T C 18: 32,127,950 (GRCm39) I581V probably benign Het
Ncdn T A 4: 126,639,066 (GRCm39) probably null Het
Ndufa4 A T 6: 11,900,574 (GRCm39) V37E probably benign Het
Nhsl1 T G 10: 18,400,412 (GRCm39) L546R probably benign Het
Nop9 T C 14: 55,988,599 (GRCm39) L347P probably damaging Het
Nrp1 A T 8: 129,224,997 (GRCm39) E782D probably damaging Het
Ntrk3 G A 7: 78,127,683 (GRCm39) probably benign Het
Or1j13 A G 2: 36,370,059 (GRCm39) S28P possibly damaging Het
Or2z8 A G 8: 72,812,280 (GRCm39) Y252C probably damaging Het
Or8g53 A T 9: 39,683,791 (GRCm39) C102S probably benign Het
Osbpl6 T A 2: 76,416,558 (GRCm39) I546K probably damaging Het
Pard6g T C 18: 80,160,523 (GRCm39) V212A probably damaging Het
Pknox2 A G 9: 36,820,980 (GRCm39) V294A probably damaging Het
Plekha1 T C 7: 130,493,983 (GRCm39) V106A probably benign Het
Plekha6 C A 1: 133,207,103 (GRCm39) probably null Het
Ptgdr A T 14: 45,096,036 (GRCm39) Y225* probably null Het
Ptpn22 A G 3: 103,781,368 (GRCm39) I90V probably damaging Het
Pygb C T 2: 150,658,692 (GRCm39) T372I probably damaging Het
Pzp T C 6: 128,468,124 (GRCm39) probably null Het
Qrich2 C T 11: 116,332,275 (GRCm39) G2307D probably damaging Het
Rfwd3 A T 8: 112,024,034 (GRCm39) V96E probably benign Het
Senp1 T A 15: 97,973,848 (GRCm39) T132S probably benign Het
Slc9a4 T G 1: 40,646,901 (GRCm39) probably null Het
Slfn9 T A 11: 82,872,133 (GRCm39) I868F probably damaging Het
St3gal6 T C 16: 58,296,234 (GRCm39) D137G probably damaging Het
Synj1 G T 16: 90,761,405 (GRCm39) A687D probably damaging Het
Syt4 A G 18: 31,576,496 (GRCm39) probably benign Het
Tacc1 A T 8: 25,654,509 (GRCm39) N271K probably damaging Het
Tdrd6 T C 17: 43,935,724 (GRCm39) T1775A probably benign Het
Tecpr1 T A 5: 144,145,463 (GRCm39) T595S probably benign Het
Tjp3 T A 10: 81,113,888 (GRCm39) M457L possibly damaging Het
Tmem200a T A 10: 25,869,825 (GRCm39) H148L probably damaging Het
Trappc8 A G 18: 20,967,997 (GRCm39) probably null Het
Txk T A 5: 72,853,922 (GRCm39) T472S probably damaging Het
Ubr4 T A 4: 139,151,256 (GRCm39) M1897K probably damaging Het
Uggt2 A G 14: 119,298,788 (GRCm39) L391P probably damaging Het
Uncx T C 5: 139,533,302 (GRCm39) S456P probably benign Het
Vps13b A G 15: 35,879,937 (GRCm39) Y3004C probably damaging Het
Vps35l T C 7: 118,393,798 (GRCm39) Y516H probably damaging Het
Zbtb46 C T 2: 181,033,224 (GRCm39) C479Y probably damaging Het
Zc3h7a A T 16: 10,968,469 (GRCm39) Y503* probably null Het
Zdhhc13 T A 7: 48,474,392 (GRCm39) L548Q possibly damaging Het
Zfp236 T C 18: 82,639,429 (GRCm39) M1225V probably benign Het
Zfp280d T C 9: 72,215,287 (GRCm39) F133L probably damaging Het
Zfp503 A T 14: 22,035,588 (GRCm39) C443S possibly damaging Het
Zfyve26 T A 12: 79,315,208 (GRCm39) I1423F possibly damaging Het
Other mutations in Crocc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Crocc APN 4 140,749,423 (GRCm39) missense probably damaging 1.00
IGL01474:Crocc APN 4 140,762,703 (GRCm39) splice site probably benign
IGL01859:Crocc APN 4 140,756,601 (GRCm39) missense probably benign 0.07
IGL02161:Crocc APN 4 140,761,302 (GRCm39) missense probably benign 0.01
IGL02244:Crocc APN 4 140,765,231 (GRCm39) missense probably benign 0.00
IGL02970:Crocc APN 4 140,757,557 (GRCm39) missense possibly damaging 0.49
N/A:Crocc UTSW 4 140,749,057 (GRCm39) missense probably damaging 1.00
R0158:Crocc UTSW 4 140,769,553 (GRCm39) splice site probably benign
R0280:Crocc UTSW 4 140,755,737 (GRCm39) missense probably damaging 1.00
R0448:Crocc UTSW 4 140,769,502 (GRCm39) missense probably damaging 1.00
R0532:Crocc UTSW 4 140,757,558 (GRCm39) missense possibly damaging 0.95
R0597:Crocc UTSW 4 140,744,382 (GRCm39) missense probably benign
R0597:Crocc UTSW 4 140,747,224 (GRCm39) missense probably benign 0.06
R0761:Crocc UTSW 4 140,774,387 (GRCm39) missense probably benign 0.01
R0761:Crocc UTSW 4 140,757,087 (GRCm39) missense probably benign 0.00
R1238:Crocc UTSW 4 140,762,675 (GRCm39) missense probably benign 0.00
R1460:Crocc UTSW 4 140,756,551 (GRCm39) nonsense probably null
R1515:Crocc UTSW 4 140,747,048 (GRCm39) missense probably benign 0.00
R1557:Crocc UTSW 4 140,752,776 (GRCm39) missense probably damaging 0.96
R1561:Crocc UTSW 4 140,757,579 (GRCm39) missense probably damaging 1.00
R1641:Crocc UTSW 4 140,744,388 (GRCm39) missense probably benign 0.00
R1709:Crocc UTSW 4 140,753,410 (GRCm39) critical splice donor site probably null
R1785:Crocc UTSW 4 140,749,113 (GRCm39) missense probably damaging 0.99
R1793:Crocc UTSW 4 140,746,620 (GRCm39) missense probably damaging 1.00
R1897:Crocc UTSW 4 140,746,047 (GRCm39) missense probably damaging 1.00
R1935:Crocc UTSW 4 140,761,369 (GRCm39) missense possibly damaging 0.78
R2037:Crocc UTSW 4 140,774,253 (GRCm39) critical splice donor site probably null
R2127:Crocc UTSW 4 140,744,407 (GRCm39) missense probably damaging 1.00
R2129:Crocc UTSW 4 140,744,407 (GRCm39) missense probably damaging 1.00
R2130:Crocc UTSW 4 140,756,413 (GRCm39) missense probably benign 0.04
R2136:Crocc UTSW 4 140,760,265 (GRCm39) missense probably damaging 1.00
R2298:Crocc UTSW 4 140,752,770 (GRCm39) missense probably benign 0.30
R2847:Crocc UTSW 4 140,746,067 (GRCm39) missense probably damaging 0.97
R2848:Crocc UTSW 4 140,746,067 (GRCm39) missense probably damaging 0.97
R2913:Crocc UTSW 4 140,747,661 (GRCm39) missense probably damaging 1.00
R3415:Crocc UTSW 4 140,773,758 (GRCm39) missense possibly damaging 0.75
R3416:Crocc UTSW 4 140,773,758 (GRCm39) missense possibly damaging 0.75
R3417:Crocc UTSW 4 140,773,758 (GRCm39) missense possibly damaging 0.75
R4082:Crocc UTSW 4 140,761,282 (GRCm39) splice site probably null
R4454:Crocc UTSW 4 140,747,716 (GRCm39) missense possibly damaging 0.52
R4591:Crocc UTSW 4 140,745,983 (GRCm39) missense probably damaging 1.00
R4597:Crocc UTSW 4 140,747,088 (GRCm39) missense probably damaging 1.00
R4984:Crocc UTSW 4 140,761,763 (GRCm39) missense probably damaging 1.00
R4992:Crocc UTSW 4 140,773,977 (GRCm39) missense probably damaging 0.98
R5109:Crocc UTSW 4 140,755,722 (GRCm39) missense probably damaging 1.00
R5143:Crocc UTSW 4 140,768,350 (GRCm39) missense probably benign 0.01
R5381:Crocc UTSW 4 140,756,622 (GRCm39) missense possibly damaging 0.95
R5684:Crocc UTSW 4 140,778,455 (GRCm39) missense probably damaging 0.99
R5757:Crocc UTSW 4 140,770,875 (GRCm39) missense probably damaging 1.00
R5795:Crocc UTSW 4 140,769,118 (GRCm39) frame shift probably null
R5796:Crocc UTSW 4 140,769,118 (GRCm39) frame shift probably null
R5798:Crocc UTSW 4 140,769,118 (GRCm39) frame shift probably null
R5815:Crocc UTSW 4 140,762,507 (GRCm39) missense probably damaging 0.99
R5955:Crocc UTSW 4 140,745,229 (GRCm39) missense possibly damaging 0.75
R6031:Crocc UTSW 4 140,761,668 (GRCm39) critical splice donor site probably null
R6063:Crocc UTSW 4 140,773,851 (GRCm39) missense probably damaging 1.00
R6063:Crocc UTSW 4 140,769,032 (GRCm39) missense probably benign 0.08
R7086:Crocc UTSW 4 140,774,368 (GRCm39) missense possibly damaging 0.47
R7282:Crocc UTSW 4 140,749,652 (GRCm39) missense probably damaging 1.00
R7293:Crocc UTSW 4 140,770,867 (GRCm39) missense probably benign 0.17
R7404:Crocc UTSW 4 140,753,497 (GRCm39) missense possibly damaging 0.46
R7571:Crocc UTSW 4 140,773,360 (GRCm39) critical splice acceptor site probably null
R7646:Crocc UTSW 4 140,748,966 (GRCm39) missense probably null 0.94
R7782:Crocc UTSW 4 140,752,597 (GRCm39) missense probably benign 0.05
R8053:Crocc UTSW 4 140,770,230 (GRCm39) critical splice donor site probably null
R8762:Crocc UTSW 4 140,761,369 (GRCm39) missense possibly damaging 0.78
R9021:Crocc UTSW 4 140,749,674 (GRCm39) missense probably benign 0.00
R9188:Crocc UTSW 4 140,747,151 (GRCm39) missense probably benign 0.04
R9272:Crocc UTSW 4 140,747,132 (GRCm39) missense probably benign 0.00
R9411:Crocc UTSW 4 140,749,577 (GRCm39) critical splice donor site probably null
R9647:Crocc UTSW 4 140,774,335 (GRCm39) missense probably benign 0.00
R9667:Crocc UTSW 4 140,748,988 (GRCm39) missense probably damaging 1.00
R9706:Crocc UTSW 4 140,746,046 (GRCm39) missense possibly damaging 0.76
R9780:Crocc UTSW 4 140,756,556 (GRCm39) missense probably benign 0.01
X0065:Crocc UTSW 4 140,769,103 (GRCm39) missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- AGGATCACAGAGAACCCTGG -3'
(R):5'- CTACACTCCTAGCAACTGAGGTG -3'

Sequencing Primer
(F):5'- AGAGAACCCTGGGGCCTG -3'
(R):5'- CCTAGCAACTGAGGTGGGAGG -3'
Posted On 2015-01-26