Mutagenetix > Incidental Mutation

Incidental Mutation 'R1565:Srsf9'

261753

Institutional Source

Beutler Lab

Gene Symbol

Srsf9

Ensembl Gene

ENSMUSG00000029538

Gene Name

serine/arginine-rich splicing factor 9

Synonyms

Sfrs9, 2610029M16Rik, SRp30c

MMRRC Submission

039604-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.436) question?

Stock #

R1565 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

115327177-115333080 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 115327370 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 21 (N21S)

Ref Sequence

ENSEMBL: ENSMUSP00000031513 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031513] [ENSMUST00000149510]

AlphaFold

Q9D0B0

PDB Structure

Solution structure of RRM domain in protein BAB31986 [SOLUTION NMR]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031513
AA Change: N21S

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000031513
Gene: ENSMUSG00000029538
AA Change: N21S

Domain	Start	End	E-Value	Type
RRM	16	86	3.76e-19	SMART
RRM	113	179	1.19e-7	SMART
low complexity region	187	207	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142318

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144000

Predicted Effect

probably benign
Transcript: ENSMUST00000149510

SMART Domains

Protein: ENSMUSP00000121845
Gene: ENSMUSG00000029538

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
RRM	54	115	3.04e-2	SMART
low complexity region	123	143	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000209604

Meta Mutation Damage Score

0.2416

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 90.0%

Validation Efficiency

96% (82/85)

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Two transcript variants, one protein-coding and the other not protein-coding, have been found for this gene. [provided by RefSeq, Sep 2010]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	G	A	11: 58,880,501	G270S	probably benign	Het
Abtb1	T	C	6: 88,836,554	T401A	probably benign	Het
Adamts14	A	T	10: 61,270,897	M148K	probably damaging	Het
Adcy5	A	G	16: 35,268,957	E508G	probably damaging	Het
Ankfy1	T	A	11: 72,757,318	L875H	probably damaging	Het
Cacng3	A	T	7: 122,768,401	D168V	probably damaging	Het
Clpb	G	A	7: 101,785,461	R488Q	probably benign	Het
Cpxm2	A	T	7: 132,062,145	Y350N	probably damaging	Het
D130040H23Rik	T	A	8: 69,303,160	*406R	probably null	Het
Dnah10	T	A	5: 124,829,614	D4236E	probably damaging	Het
Dpf3	T	A	12: 83,370,617	Y27F	probably damaging	Het
Esp4	T	C	17: 40,602,595	*118Q	probably null	Het
Fam222b	T	C	11: 78,154,662	S222P	possibly damaging	Het
Flnc	T	C	6: 29,455,171	V1933A	probably damaging	Het
Gem	T	C	4: 11,713,709	F282L	possibly damaging	Het
Gli2	T	C	1: 118,841,930	T631A	possibly damaging	Het
Gm13088	G	A	4: 143,655,617	Q170*	probably null	Het
Gpld1	T	A	13: 24,956,068	V116E	probably damaging	Het
Gpr176	A	G	2: 118,280,214	M188T	probably benign	Het
Grk5	T	C	19: 61,089,972	V489A	probably damaging	Het
H2-Ke6	C	T	17: 34,027,495	V105I	possibly damaging	Het
Hpdl	T	C	4: 116,820,883	N127S	probably damaging	Het
Id4	G	T	13: 48,262,294	V151L	possibly damaging	Het
Kcnh8	G	T	17: 52,956,881	G802V	probably benign	Het
Lamc1	C	A	1: 153,242,743	S894I	probably benign	Het
Larp1b	A	G	3: 40,972,384	N184S	probably damaging	Het
Lhx1	A	T	11: 84,519,821	S226T	probably benign	Het
Lmo7	A	T	14: 101,887,521	Q472L	probably damaging	Het
Mog	G	C	17: 37,017,582	N152K	possibly damaging	Het
Mttp	A	G	3: 138,116,405		probably null	Het
Mycbp2	A	G	14: 103,252,509	V953A	possibly damaging	Het
Myo3a	A	T	2: 22,340,280	Y509F	probably damaging	Het
Myo9b	A	G	8: 71,315,192	N303S	possibly damaging	Het
Nek3	T	C	8: 22,132,201		probably null	Het
Nlrc4	A	T	17: 74,441,931	D771E	probably benign	Het
Nup160	A	T	2: 90,722,061	N1127I	possibly damaging	Het
Oas1h	A	T	5: 120,862,600	N91I	probably damaging	Het
Olfr1225	A	T	2: 89,170,627	V195D	probably benign	Het
Olfr1226	G	T	2: 89,193,883	S50R	probably damaging	Het
Olfr1342	T	A	4: 118,690,192	N87Y	probably damaging	Het
Parp4	T	C	14: 56,589,872		probably benign	Het
Pi4ka	G	A	16: 17,281,900	C96Y	probably null	Het
Pira2	A	T	7: 3,844,549	F47Y	probably damaging	Het
Pkhd1	C	A	1: 20,347,457	G2490V	probably damaging	Het
Plekhg1	C	T	10: 3,940,526	T394I	probably damaging	Het
Psmd1	T	C	1: 86,091,997		probably benign	Het
Rab3ip	A	T	10: 116,939,223	C77S	probably benign	Het
Reln	A	T	5: 21,925,213	M2700K	probably benign	Het
Rfx1	A	G	8: 84,073,946	T59A	probably benign	Het
Ric8b	G	T	10: 84,980,099	V405L	probably benign	Het
Rufy3	G	T	5: 88,640,632	A479S	probably damaging	Het
Sardh	A	T	2: 27,242,719	Y166N	probably damaging	Het
Slamf6	T	G	1: 171,934,408	V132G	possibly damaging	Het
Slc12a3	T	G	8: 94,345,877	H674Q	possibly damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Stkld1	A	T	2: 26,950,090	T391S	probably benign	Het
Sumf2	C	A	5: 129,859,914	N230K	probably damaging	Het
Tbc1d22a	T	C	15: 86,235,569	V22A	possibly damaging	Het
Thsd7b	T	A	1: 129,596,041	S194T	possibly damaging	Het
Tmem27	A	G	X: 164,118,234	D184G	possibly damaging	Het
Tnn	T	A	1: 160,097,265	Y1173F	probably damaging	Het
Top2a	A	G	11: 99,001,054	F1122L	probably damaging	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Trim39	G	A	17: 36,268,854	R70W	probably damaging	Het
Ttn	G	A	2: 76,794,261	T15289I	probably damaging	Het
Ugt2b38	A	T	5: 87,411,914	V373E	probably damaging	Het
Usp54	A	G	14: 20,607,159	S24P	probably damaging	Het
Vmn2r27	C	T	6: 124,231,634	G51S	probably benign	Het
Xylt2	C	T	11: 94,667,594	A579T	probably benign	Het
Zbtb21	A	G	16: 97,952,427	S247P	probably benign	Het
Zc3h7b	C	T	15: 81,777,088	P376L	probably benign	Het
Zfp251	T	A	15: 76,853,038	R613S	probably damaging	Het
Zfp251	C	T	15: 76,853,039	R613K	possibly damaging	Het
Zfp91	T	C	19: 12,779,075	D135G	probably benign	Het

Other mutations in Srsf9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01462:Srsf9	APN	5	115332128	missense	probably damaging	1.00
R0137:Srsf9	UTSW	5	115332201	missense	possibly damaging	0.64
R0603:Srsf9	UTSW	5	115332637	missense	probably damaging	0.99
R1781:Srsf9	UTSW	5	115327422	nonsense	probably null
R2942:Srsf9	UTSW	5	115332693	missense	probably damaging	1.00
R3622:Srsf9	UTSW	5	115330512	missense	probably damaging	0.98
R3689:Srsf9	UTSW	5	115327328	missense	probably benign	0.00
R4492:Srsf9	UTSW	5	115332592	missense	probably damaging	1.00
R5345:Srsf9	UTSW	5	115330536	missense	probably benign	0.03
R5840:Srsf9	UTSW	5	115331465	missense	probably benign
R6355:Srsf9	UTSW	5	115327309	start codon destroyed	probably null	0.04
R7207:Srsf9	UTSW	5	115327422	nonsense	probably null
R7672:Srsf9	UTSW	5	115330560	missense	probably damaging	1.00
R8466:Srsf9	UTSW	5	115327433	missense	probably benign	0.40
R8871:Srsf9	UTSW	5	115330653	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGGACAGCCCCAAGCTTAGTGAC -3'
(R):5'- TTCCGATTGAAGGAAGTGACACCAG -3'

Sequencing Primer
(F):5'- CTTAGTGACCTACCAGCTTAGGAG -3'
(R):5'- gggagggggaggggaag -3'

Posted On

2015-01-30