Incidental Mutation 'R1565:Srsf9'
ID 261753
Institutional Source Beutler Lab
Gene Symbol Srsf9
Ensembl Gene ENSMUSG00000029538
Gene Name serine/arginine-rich splicing factor 9
Synonyms Sfrs9, 2610029M16Rik, SRp30c
MMRRC Submission 039604-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.436) question?
Stock # R1565 (G1)
Quality Score 22
Status Validated
Chromosome 5
Chromosomal Location 115327177-115333080 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 115327370 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 21 (N21S)
Ref Sequence ENSEMBL: ENSMUSP00000031513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031513] [ENSMUST00000149510]
AlphaFold Q9D0B0
PDB Structure Solution structure of RRM domain in protein BAB31986 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031513
AA Change: N21S

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000031513
Gene: ENSMUSG00000029538
AA Change: N21S

DomainStartEndE-ValueType
RRM 16 86 3.76e-19 SMART
RRM 113 179 1.19e-7 SMART
low complexity region 187 207 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144000
Predicted Effect probably benign
Transcript: ENSMUST00000149510
SMART Domains Protein: ENSMUSP00000121845
Gene: ENSMUSG00000029538

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
RRM 54 115 3.04e-2 SMART
low complexity region 123 143 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209604
Meta Mutation Damage Score 0.2416 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.0%
Validation Efficiency 96% (82/85)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Two transcript variants, one protein-coding and the other not protein-coding, have been found for this gene. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik G A 11: 58,880,501 G270S probably benign Het
Abtb1 T C 6: 88,836,554 T401A probably benign Het
Adamts14 A T 10: 61,270,897 M148K probably damaging Het
Adcy5 A G 16: 35,268,957 E508G probably damaging Het
Ankfy1 T A 11: 72,757,318 L875H probably damaging Het
Cacng3 A T 7: 122,768,401 D168V probably damaging Het
Clpb G A 7: 101,785,461 R488Q probably benign Het
Cpxm2 A T 7: 132,062,145 Y350N probably damaging Het
D130040H23Rik T A 8: 69,303,160 *406R probably null Het
Dnah10 T A 5: 124,829,614 D4236E probably damaging Het
Dpf3 T A 12: 83,370,617 Y27F probably damaging Het
Esp4 T C 17: 40,602,595 *118Q probably null Het
Fam222b T C 11: 78,154,662 S222P possibly damaging Het
Flnc T C 6: 29,455,171 V1933A probably damaging Het
Gem T C 4: 11,713,709 F282L possibly damaging Het
Gli2 T C 1: 118,841,930 T631A possibly damaging Het
Gm13088 G A 4: 143,655,617 Q170* probably null Het
Gpld1 T A 13: 24,956,068 V116E probably damaging Het
Gpr176 A G 2: 118,280,214 M188T probably benign Het
Grk5 T C 19: 61,089,972 V489A probably damaging Het
H2-Ke6 C T 17: 34,027,495 V105I possibly damaging Het
Hpdl T C 4: 116,820,883 N127S probably damaging Het
Id4 G T 13: 48,262,294 V151L possibly damaging Het
Kcnh8 G T 17: 52,956,881 G802V probably benign Het
Lamc1 C A 1: 153,242,743 S894I probably benign Het
Larp1b A G 3: 40,972,384 N184S probably damaging Het
Lhx1 A T 11: 84,519,821 S226T probably benign Het
Lmo7 A T 14: 101,887,521 Q472L probably damaging Het
Mog G C 17: 37,017,582 N152K possibly damaging Het
Mttp A G 3: 138,116,405 probably null Het
Mycbp2 A G 14: 103,252,509 V953A possibly damaging Het
Myo3a A T 2: 22,340,280 Y509F probably damaging Het
Myo9b A G 8: 71,315,192 N303S possibly damaging Het
Nek3 T C 8: 22,132,201 probably null Het
Nlrc4 A T 17: 74,441,931 D771E probably benign Het
Nup160 A T 2: 90,722,061 N1127I possibly damaging Het
Oas1h A T 5: 120,862,600 N91I probably damaging Het
Olfr1225 A T 2: 89,170,627 V195D probably benign Het
Olfr1226 G T 2: 89,193,883 S50R probably damaging Het
Olfr1342 T A 4: 118,690,192 N87Y probably damaging Het
Parp4 T C 14: 56,589,872 probably benign Het
Pi4ka G A 16: 17,281,900 C96Y probably null Het
Pira2 A T 7: 3,844,549 F47Y probably damaging Het
Pkhd1 C A 1: 20,347,457 G2490V probably damaging Het
Plekhg1 C T 10: 3,940,526 T394I probably damaging Het
Psmd1 T C 1: 86,091,997 probably benign Het
Rab3ip A T 10: 116,939,223 C77S probably benign Het
Reln A T 5: 21,925,213 M2700K probably benign Het
Rfx1 A G 8: 84,073,946 T59A probably benign Het
Ric8b G T 10: 84,980,099 V405L probably benign Het
Rufy3 G T 5: 88,640,632 A479S probably damaging Het
Sardh A T 2: 27,242,719 Y166N probably damaging Het
Slamf6 T G 1: 171,934,408 V132G possibly damaging Het
Slc12a3 T G 8: 94,345,877 H674Q possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Stkld1 A T 2: 26,950,090 T391S probably benign Het
Sumf2 C A 5: 129,859,914 N230K probably damaging Het
Tbc1d22a T C 15: 86,235,569 V22A possibly damaging Het
Thsd7b T A 1: 129,596,041 S194T possibly damaging Het
Tmem27 A G X: 164,118,234 D184G possibly damaging Het
Tnn T A 1: 160,097,265 Y1173F probably damaging Het
Top2a A G 11: 99,001,054 F1122L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim39 G A 17: 36,268,854 R70W probably damaging Het
Ttn G A 2: 76,794,261 T15289I probably damaging Het
Ugt2b38 A T 5: 87,411,914 V373E probably damaging Het
Usp54 A G 14: 20,607,159 S24P probably damaging Het
Vmn2r27 C T 6: 124,231,634 G51S probably benign Het
Xylt2 C T 11: 94,667,594 A579T probably benign Het
Zbtb21 A G 16: 97,952,427 S247P probably benign Het
Zc3h7b C T 15: 81,777,088 P376L probably benign Het
Zfp251 T A 15: 76,853,038 R613S probably damaging Het
Zfp251 C T 15: 76,853,039 R613K possibly damaging Het
Zfp91 T C 19: 12,779,075 D135G probably benign Het
Other mutations in Srsf9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Srsf9 APN 5 115332128 missense probably damaging 1.00
R0137:Srsf9 UTSW 5 115332201 missense possibly damaging 0.64
R0603:Srsf9 UTSW 5 115332637 missense probably damaging 0.99
R1781:Srsf9 UTSW 5 115327422 nonsense probably null
R2942:Srsf9 UTSW 5 115332693 missense probably damaging 1.00
R3622:Srsf9 UTSW 5 115330512 missense probably damaging 0.98
R3689:Srsf9 UTSW 5 115327328 missense probably benign 0.00
R4492:Srsf9 UTSW 5 115332592 missense probably damaging 1.00
R5345:Srsf9 UTSW 5 115330536 missense probably benign 0.03
R5840:Srsf9 UTSW 5 115331465 missense probably benign
R6355:Srsf9 UTSW 5 115327309 start codon destroyed probably null 0.04
R7207:Srsf9 UTSW 5 115327422 nonsense probably null
R7672:Srsf9 UTSW 5 115330560 missense probably damaging 1.00
R8466:Srsf9 UTSW 5 115327433 missense probably benign 0.40
R8871:Srsf9 UTSW 5 115330653 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGACAGCCCCAAGCTTAGTGAC -3'
(R):5'- TTCCGATTGAAGGAAGTGACACCAG -3'

Sequencing Primer
(F):5'- CTTAGTGACCTACCAGCTTAGGAG -3'
(R):5'- gggagggggaggggaag -3'
Posted On 2015-01-30