Incidental Mutation 'R0467:Tmem200a'
ID261900
Institutional Source Beutler Lab
Gene Symbol Tmem200a
Ensembl Gene ENSMUSG00000049420
Gene Nametransmembrane protein 200A
Synonyms
MMRRC Submission 038667-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R0467 (G1)
Quality Score55
Status Validated
Chromosome10
Chromosomal Location25912331-26079052 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25994104 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 89 (H89R)
Ref Sequence ENSEMBL: ENSMUSP00000151861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066049] [ENSMUST00000218232] [ENSMUST00000219338] [ENSMUST00000219651] [ENSMUST00000219872]
Predicted Effect probably benign
Transcript: ENSMUST00000066049
AA Change: H89R

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000064080
Gene: ENSMUSG00000049420
AA Change: H89R

DomainStartEndE-ValueType
Pfam:DUF2371 16 161 8.9e-62 PFAM
low complexity region 262 279 N/A INTRINSIC
low complexity region 387 401 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217910
Predicted Effect probably benign
Transcript: ENSMUST00000218232
AA Change: H89R

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000219338
AA Change: H89R

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000219651
AA Change: H89R

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000219872
Meta Mutation Damage Score 0.0619 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,715 S683P probably benign Het
2310007B03Rik A T 1: 93,153,044 I380N probably damaging Het
4931423N10Rik A G 2: 23,212,820 E190G possibly damaging Het
4933416C03Rik G A 10: 116,113,153 A156V probably benign Het
Abca17 A G 17: 24,313,177 probably benign Het
Anapc1 A G 2: 128,669,043 I511T probably damaging Het
Atf6 A T 1: 170,794,020 H477Q probably damaging Het
C4b A G 17: 34,736,127 V795A probably benign Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cdk12 T C 11: 98,203,579 V71A probably damaging Het
Cul3 A T 1: 80,280,863 D419E probably benign Het
Ddi2 A G 4: 141,685,184 I139T probably benign Het
Dnaaf1 T A 8: 119,590,732 D333E probably benign Het
Dnase1 A G 16: 4,039,149 D7G probably damaging Het
Fam71f1 G A 6: 29,326,607 S241N probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Galc A C 12: 98,242,645 I250R probably damaging Het
Gcfc2 T C 6: 81,923,882 V59A possibly damaging Het
Gm6133 A C 18: 78,350,090 S100R probably benign Het
Iba57 T C 11: 59,163,439 T85A probably benign Het
Ipo4 A T 14: 55,635,526 M1K probably null Het
Ippk A G 13: 49,430,865 probably null Het
Kcnk10 A T 12: 98,489,945 I209N probably benign Het
Klk14 T C 7: 43,694,110 L122P probably benign Het
Ltbp1 T A 17: 75,282,429 probably null Het
Mcm3 T C 1: 20,804,847 D737G probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Nalcn T A 14: 123,291,047 T1456S probably benign Het
Nckap1l C T 15: 103,497,427 P1097S probably benign Het
Ncoa1 A G 12: 4,267,687 M1215T possibly damaging Het
Nomo1 T A 7: 46,072,487 probably null Het
Obox5 T A 7: 15,758,007 C116S possibly damaging Het
Olfr644 C T 7: 104,068,125 R302H probably benign Het
Olfr701 T A 7: 106,818,361 S93T possibly damaging Het
Olfr76 C A 19: 12,120,536 A59S probably benign Het
Pcdhb14 G T 18: 37,449,224 R461L probably damaging Het
Pdgfra A G 5: 75,195,036 D1069G probably damaging Het
Pgr C T 9: 8,900,778 A104V possibly damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Rassf3 A G 10: 121,417,204 probably benign Het
Rgs22 G T 15: 36,099,795 S258* probably null Het
Rsph6a C A 7: 19,057,669 D254E possibly damaging Het
Sgk1 A G 10: 21,996,358 probably benign Het
Shcbp1l G A 1: 153,433,182 C174Y probably damaging Het
Sulf1 T A 1: 12,796,920 N109K probably damaging Het
Tas2r115 T A 6: 132,737,719 I90L probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Xrn1 T C 9: 96,024,191 S1212P probably damaging Het
Zfp408 T C 2: 91,645,537 Y424C possibly damaging Het
Other mutations in Tmem200a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Tmem200a APN 10 25994143 missense probably damaging 0.98
IGL02323:Tmem200a APN 10 25993430 missense probably benign 0.12
IGL02702:Tmem200a APN 10 25993603 missense probably damaging 1.00
IGL03221:Tmem200a APN 10 25994024 missense possibly damaging 0.54
R1169:Tmem200a UTSW 10 25994348 missense probably damaging 1.00
R1543:Tmem200a UTSW 10 26078620 unclassified probably benign
R1555:Tmem200a UTSW 10 25993884 missense probably damaging 1.00
R1630:Tmem200a UTSW 10 25992914 missense probably damaging 1.00
R1693:Tmem200a UTSW 10 25993979 missense possibly damaging 0.94
R1786:Tmem200a UTSW 10 25993927 missense probably damaging 1.00
R1891:Tmem200a UTSW 10 25994072 missense probably damaging 1.00
R2113:Tmem200a UTSW 10 25993322 missense probably damaging 1.00
R2260:Tmem200a UTSW 10 25993415 missense probably benign
R3793:Tmem200a UTSW 10 25994189 missense probably damaging 1.00
R5062:Tmem200a UTSW 10 25993915 missense probably damaging 1.00
R5178:Tmem200a UTSW 10 25994379 missense probably benign 0.02
R5195:Tmem200a UTSW 10 26078956 unclassified probably benign
R5208:Tmem200a UTSW 10 25994153 missense probably benign 0.00
R6045:Tmem200a UTSW 10 25993007 missense probably damaging 1.00
R6319:Tmem200a UTSW 10 25993495 missense probably damaging 1.00
R6552:Tmem200a UTSW 10 25993483 missense probably damaging 1.00
R7797:Tmem200a UTSW 10 25993966 missense possibly damaging 0.95
R8009:Tmem200a UTSW 10 25994006 missense probably damaging 1.00
R8074:Tmem200a UTSW 10 25992952 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCTCCTTGAGTCTCAGAGTGTG -3'
(R):5'- TGCCTGCTACCCAGGATCAGAAAC -3'

Sequencing Primer
(F):5'- CGATGACTGTGGAGTAGATATCCC -3'
(R):5'- GAAACCCGTCAGACGGC -3'
Posted On2015-02-04