Incidental Mutation 'R0550:Or5b97'
ID 261934
Institutional Source Beutler Lab
Gene Symbol Or5b97
Ensembl Gene ENSMUSG00000060303
Gene Name olfactory receptor family 5 subfamily B member 97
Synonyms MOR202-3, Olfr1447, GA_x6K02T2RE5P-3231251-3230331
MMRRC Submission 038742-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R0550 (G1)
Quality Score 218
Status Not validated
Chromosome 19
Chromosomal Location 12878213-12879142 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 12879164 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071484] [ENSMUST00000071484] [ENSMUST00000208343] [ENSMUST00000208343] [ENSMUST00000216989] [ENSMUST00000216989]
AlphaFold Q8VFX3
Predicted Effect probably null
Transcript: ENSMUST00000071484
SMART Domains Protein: ENSMUSP00000071419
Gene: ENSMUSG00000060303

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 5.3e-50 PFAM
Pfam:7TM_GPCR_Srsx 36 306 2.1e-7 PFAM
Pfam:7tm_1 42 291 7.4e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000071484
SMART Domains Protein: ENSMUSP00000071419
Gene: ENSMUSG00000060303

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 5.3e-50 PFAM
Pfam:7TM_GPCR_Srsx 36 306 2.1e-7 PFAM
Pfam:7tm_1 42 291 7.4e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000208343
Predicted Effect probably null
Transcript: ENSMUST00000208343
Predicted Effect probably null
Transcript: ENSMUST00000216989
Predicted Effect probably null
Transcript: ENSMUST00000216989
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218013
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220222
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,184,666 (GRCm39) Y947N probably damaging Het
Acss3 C A 10: 106,889,332 (GRCm39) G163C probably damaging Het
Adcy10 A G 1: 165,392,884 (GRCm39) T1367A probably benign Het
Adcy2 A T 13: 69,130,480 (GRCm39) S136T probably benign Het
Ahdc1 G A 4: 132,790,348 (GRCm39) V530I probably benign Het
Aldh16a1 C T 7: 44,795,653 (GRCm39) probably null Het
Ankrd36 T C 11: 5,557,429 (GRCm39) probably null Het
Aqr A C 2: 113,963,457 (GRCm39) N664K probably damaging Het
Atp6v1c1 T C 15: 38,683,173 (GRCm39) probably benign Het
Atp8b2 C T 3: 89,866,368 (GRCm39) probably benign Het
Bbx T C 16: 50,094,896 (GRCm39) probably benign Het
Bmper T A 9: 23,285,181 (GRCm39) D243E probably benign Het
Casz1 GCCACCACCACCACCACCACCAC GCCACCACCACCACCACCAC 4: 149,036,741 (GRCm39) probably benign Het
Catsperd T C 17: 56,970,427 (GRCm39) probably null Het
Ccdc92b T A 11: 74,520,771 (GRCm39) probably null Het
Cd2bp2 G T 7: 126,792,996 (GRCm39) T342K probably damaging Het
Clrn3 T A 7: 135,130,154 (GRCm39) I27F possibly damaging Het
Cnih3 TTGACGAG T 1: 181,234,042 (GRCm39) probably null Het
Cntnap3 T C 13: 64,909,814 (GRCm39) T764A possibly damaging Het
Cttnbp2 T G 6: 18,435,308 (GRCm39) K183N possibly damaging Het
Cwc27 G A 13: 104,941,457 (GRCm39) P155L probably damaging Het
Dcaf10 T C 4: 45,372,753 (GRCm39) S389P probably benign Het
Ddx18 T C 1: 121,483,104 (GRCm39) K561E probably benign Het
Dkk3 A G 7: 111,757,452 (GRCm39) F51L probably damaging Het
Dnai1 C T 4: 41,596,274 (GRCm39) R20* probably null Het
Dr1 G A 5: 108,417,471 (GRCm39) G6S probably benign Het
Dync2h1 A T 9: 7,120,954 (GRCm39) probably null Het
Eif3l A G 15: 78,961,067 (GRCm39) Y16C probably damaging Het
Epb41 A G 4: 131,702,924 (GRCm39) I464T probably damaging Het
Erc2 A G 14: 27,993,608 (GRCm39) K546E possibly damaging Het
F830045P16Rik T C 2: 129,305,429 (GRCm39) D315G probably damaging Het
Fads6 A G 11: 115,187,503 (GRCm39) I64T probably benign Het
Fshr T C 17: 89,352,553 (GRCm39) N107S probably benign Het
Gbp11 A T 5: 105,491,616 (GRCm39) N60K probably benign Het
Gm2a C T 11: 54,994,491 (GRCm39) Q54* probably null Het
Hydin A G 8: 111,314,407 (GRCm39) D4297G probably benign Het
Il6st G A 13: 112,611,648 (GRCm39) probably null Het
Inpp4b T A 8: 82,723,966 (GRCm39) H499Q probably benign Het
Kif5c A G 2: 49,648,924 (GRCm39) K956R possibly damaging Het
Krt74 G A 15: 101,669,114 (GRCm39) noncoding transcript Het
Map3k9 A T 12: 81,772,555 (GRCm39) L649Q probably damaging Het
Mdn1 A G 4: 32,730,479 (GRCm39) D2871G probably benign Het
Mylk4 T C 13: 32,900,649 (GRCm39) T294A probably benign Het
Nbeal2 C T 9: 110,471,226 (GRCm39) V252I probably benign Het
Nectin3 A G 16: 46,279,183 (GRCm39) I265T possibly damaging Het
Opn1sw A T 6: 29,380,203 (GRCm39) L71Q probably damaging Het
Or4c12 A G 2: 89,773,733 (GRCm39) I242T probably damaging Het
Or52m1 G A 7: 102,290,157 (GRCm39) E235K possibly damaging Het
Or5aq6 G T 2: 86,923,473 (GRCm39) H89Q probably benign Het
Or5k17 A G 16: 58,746,748 (GRCm39) F62S probably damaging Het
Or8b46 T A 9: 38,450,676 (GRCm39) C162S probably damaging Het
Or8k27 A T 2: 86,276,220 (GRCm39) Y35* probably null Het
Pced1a G A 2: 130,261,553 (GRCm39) P367S probably benign Het
Pkhd1 A T 1: 20,417,447 (GRCm39) M2568K probably null Het
Pla2r1 A G 2: 60,255,694 (GRCm39) probably null Het
Plpp1 T C 13: 112,971,519 (GRCm39) I62T probably benign Het
Polr3g G A 13: 81,842,892 (GRCm39) T41I probably damaging Het
Ptch2 T C 4: 116,953,630 (GRCm39) probably benign Het
Sema4g A T 19: 44,986,104 (GRCm39) H315L probably benign Het
Setd1b G T 5: 123,295,723 (GRCm39) S1097I unknown Het
Sfxn4 A G 19: 60,839,383 (GRCm39) probably benign Het
Sh3tc1 T C 5: 35,857,128 (GRCm39) E1237G probably damaging Het
Slc25a38 A T 9: 119,952,709 (GRCm39) N287I probably benign Het
Slc25a48 A G 13: 56,596,811 (GRCm39) T31A probably benign Het
Slc6a12 G A 6: 121,333,877 (GRCm39) V238I probably damaging Het
Slc8b1 A G 5: 120,669,220 (GRCm39) probably benign Het
Slco4c1 A C 1: 96,795,584 (GRCm39) V158G probably damaging Het
Sptbn4 T C 7: 27,063,803 (GRCm39) T2208A probably benign Het
Srebf1 G A 11: 60,092,502 (GRCm39) T843I probably benign Het
Srl A G 16: 4,305,429 (GRCm39) W101R probably damaging Het
St6galnac4 T A 2: 32,484,031 (GRCm39) C76* probably null Het
Tdrd3 C A 14: 87,723,656 (GRCm39) T290K probably damaging Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Trpm3 A G 19: 22,965,176 (GRCm39) E1547G probably damaging Het
Ubn1 A G 16: 4,880,484 (GRCm39) probably null Het
Usp10 T A 8: 120,674,540 (GRCm39) I456K probably damaging Het
Usp6nl A G 2: 6,405,134 (GRCm39) probably benign Het
Vit T A 17: 78,932,222 (GRCm39) V443E possibly damaging Het
Whamm G A 7: 81,235,972 (GRCm39) V392I possibly damaging Het
Zfhx4 A G 3: 5,465,554 (GRCm39) K1904R probably damaging Het
Zfp352 A T 4: 90,112,927 (GRCm39) T356S probably damaging Het
Other mutations in Or5b97
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Or5b97 APN 19 12,878,719 (GRCm39) missense probably benign 0.40
IGL01704:Or5b97 APN 19 12,879,103 (GRCm39) missense probably benign 0.01
IGL01767:Or5b97 APN 19 12,879,112 (GRCm39) missense probably benign 0.12
IGL01969:Or5b97 APN 19 12,878,416 (GRCm39) missense possibly damaging 0.69
IGL02435:Or5b97 APN 19 12,878,391 (GRCm39) missense probably damaging 1.00
IGL02666:Or5b97 APN 19 12,878,221 (GRCm39) missense probably benign
IGL03034:Or5b97 APN 19 12,879,121 (GRCm39) missense possibly damaging 0.94
IGL03221:Or5b97 APN 19 12,878,905 (GRCm39) missense probably damaging 1.00
R0315:Or5b97 UTSW 19 12,878,598 (GRCm39) missense possibly damaging 0.66
R0729:Or5b97 UTSW 19 12,878,259 (GRCm39) missense probably damaging 0.97
R1381:Or5b97 UTSW 19 12,878,320 (GRCm39) missense probably benign 0.00
R1669:Or5b97 UTSW 19 12,878,652 (GRCm39) missense possibly damaging 0.79
R1775:Or5b97 UTSW 19 12,878,599 (GRCm39) missense probably benign 0.02
R1918:Or5b97 UTSW 19 12,878,215 (GRCm39) makesense probably null
R2377:Or5b97 UTSW 19 12,878,217 (GRCm39) missense possibly damaging 0.45
R2406:Or5b97 UTSW 19 12,878,991 (GRCm39) missense probably benign 0.11
R2471:Or5b97 UTSW 19 12,878,679 (GRCm39) missense probably benign 0.00
R2484:Or5b97 UTSW 19 12,879,005 (GRCm39) missense probably benign 0.06
R2656:Or5b97 UTSW 19 12,879,030 (GRCm39) missense probably benign 0.37
R3888:Or5b97 UTSW 19 12,878,497 (GRCm39) missense probably benign 0.00
R4250:Or5b97 UTSW 19 12,878,368 (GRCm39) missense probably benign 0.09
R4545:Or5b97 UTSW 19 12,878,632 (GRCm39) nonsense probably null
R4895:Or5b97 UTSW 19 12,878,251 (GRCm39) missense probably damaging 1.00
R4956:Or5b97 UTSW 19 12,878,963 (GRCm39) missense probably damaging 0.99
R4991:Or5b97 UTSW 19 12,878,815 (GRCm39) missense probably damaging 0.98
R5044:Or5b97 UTSW 19 12,878,365 (GRCm39) missense probably damaging 1.00
R5165:Or5b97 UTSW 19 12,878,564 (GRCm39) missense probably benign 0.00
R6025:Or5b97 UTSW 19 12,879,034 (GRCm39) missense probably benign 0.10
R6135:Or5b97 UTSW 19 12,878,803 (GRCm39) missense probably damaging 0.97
R6459:Or5b97 UTSW 19 12,878,369 (GRCm39) missense possibly damaging 0.94
R6733:Or5b97 UTSW 19 12,878,605 (GRCm39) missense probably damaging 1.00
R6789:Or5b97 UTSW 19 12,878,653 (GRCm39) missense probably benign 0.21
R6923:Or5b97 UTSW 19 12,878,676 (GRCm39) missense probably benign 0.04
R7310:Or5b97 UTSW 19 12,878,637 (GRCm39) missense probably damaging 1.00
R8552:Or5b97 UTSW 19 12,879,096 (GRCm39) missense probably damaging 0.98
R8699:Or5b97 UTSW 19 12,878,828 (GRCm39) missense possibly damaging 0.59
R8735:Or5b97 UTSW 19 12,878,274 (GRCm39) missense possibly damaging 0.85
R8955:Or5b97 UTSW 19 12,878,578 (GRCm39) missense probably benign 0.01
R9626:Or5b97 UTSW 19 12,878,600 (GRCm39) missense possibly damaging 0.88
R9631:Or5b97 UTSW 19 12,878,502 (GRCm39) missense possibly damaging 0.69
R9694:Or5b97 UTSW 19 12,879,021 (GRCm39) missense probably damaging 0.97
Predicted Primers
Posted On 2015-02-04