Incidental Mutation 'R0605:Plppr1'
ID261950
Institutional Source Beutler Lab
Gene Symbol Plppr1
Ensembl Gene ENSMUSG00000063446
Gene Namephospholipid phosphatase related 1
SynonymsPRG-3, E130309F12Rik, Lppr1
MMRRC Submission 038794-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.295) question?
Stock #R0605 (G1)
Quality Score62
Status Validated
Chromosome4
Chromosomal Location49059273-49340259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49323466 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 252 (N252I)
Ref Sequence ENSEMBL: ENSMUSP00000075966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076670]
Predicted Effect probably damaging
Transcript: ENSMUST00000076670
AA Change: N252I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075966
Gene: ENSMUSG00000063446
AA Change: N252I

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
acidPPc 128 272 4.47e-16 SMART
Meta Mutation Damage Score 0.7204 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plasticity-related gene (PRG) family. Members of the PRG family mediate lipid phosphate phosphatase activity in neurons and are known to be involved in neuronal plasticity. The protein encoded by this gene does not perform its function through enzymatic phospholipid degradation. This gene is strongly expressed in brain. It shows dynamic expression regulation during brain development and neuronal excitation. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406P04Rik G A 10: 20,311,227 probably benign Het
Adam28 A T 14: 68,606,600 probably benign Het
Adamts3 A G 5: 89,861,475 W110R possibly damaging Het
Add1 T C 5: 34,614,224 V342A possibly damaging Het
Aff3 A G 1: 38,209,987 S680P probably damaging Het
Ak9 T C 10: 41,345,139 Y322H probably damaging Het
Als2 A G 1: 59,168,414 L1528S probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atp6v1a A C 16: 44,111,496 probably null Het
Bpi T C 2: 158,261,394 L103P probably damaging Het
Cd80 G A 16: 38,482,694 V168I probably benign Het
Cfh T C 1: 140,102,358 S926G probably damaging Het
Chrd A T 16: 20,735,439 T304S probably damaging Het
Chsy3 A G 18: 59,409,053 Y421C probably damaging Het
Cmbl T G 15: 31,585,309 V101G probably damaging Het
Colgalt2 T A 1: 152,495,792 probably benign Het
Coq4 C T 2: 29,789,998 Q101* probably null Het
Cr2 T C 1: 195,163,596 probably benign Het
Cry1 T C 10: 85,184,359 D38G probably damaging Het
Dmxl2 T C 9: 54,419,945 D758G probably benign Het
Epsti1 C T 14: 77,927,237 probably benign Het
Fam24b T C 7: 131,327,186 probably benign Het
Fem1c G A 18: 46,505,160 R592C probably benign Het
Foxred1 T C 9: 35,204,882 Y490C possibly damaging Het
Gm14124 A G 2: 150,268,603 I404M unknown Het
Gm9875 A G 2: 13,557,888 K9R unknown Het
Grid2ip T C 5: 143,379,362 S322P probably damaging Het
Gucy1b2 A G 14: 62,403,159 probably benign Het
Hmcn1 A T 1: 150,657,376 probably null Het
Hpdl C T 4: 116,820,787 S159N possibly damaging Het
Hsd17b12 A T 2: 94,033,642 M285K probably benign Het
Icam5 T C 9: 21,032,197 I23T probably benign Het
Kat5 A G 19: 5,608,336 probably benign Het
Lama3 A G 18: 12,506,949 N67S probably benign Het
Lamb2 T C 9: 108,486,105 probably benign Het
Lgals3bp A G 11: 118,393,394 F453S probably damaging Het
Lypd4 A G 7: 24,865,375 Y113H probably damaging Het
Mdm1 C T 10: 118,146,601 T47M probably damaging Het
Mei1 C A 15: 82,070,150 T52K probably benign Het
Meiob G A 17: 24,818,262 probably benign Het
Ndufaf6 A G 4: 11,051,224 V292A probably damaging Het
Neb T A 2: 52,264,026 M2358L possibly damaging Het
Nlrp1b A G 11: 71,156,179 S1119P possibly damaging Het
Nsmaf A G 4: 6,418,470 probably null Het
Ogfod1 T C 8: 94,047,267 probably benign Het
Olfr1097 T C 2: 86,890,419 Y252C possibly damaging Het
Olfr1410 G T 1: 92,607,896 V20L probably benign Het
Olfr291 T C 7: 84,857,137 I256T probably damaging Het
Osbpl1a T A 18: 12,882,279 probably null Het
Otud7b T A 3: 96,144,959 probably benign Het
P3h3 T A 6: 124,856,035 H185L probably damaging Het
P4htm G A 9: 108,583,724 A183V probably null Het
Peak1 C T 9: 56,227,098 probably benign Het
Phf20l1 A G 15: 66,595,122 K88R probably damaging Het
Phlpp2 A G 8: 109,933,211 N721S probably benign Het
Plagl2 T C 2: 153,235,944 K39R probably benign Het
Pom121l2 C T 13: 21,982,036 A159V probably damaging Het
Prom2 C A 2: 127,539,995 probably null Het
Prrc2c T C 1: 162,682,426 T1017A probably damaging Het
Rimbp3 G T 16: 17,211,699 A996S probably damaging Het
Rnf213 A G 11: 119,431,717 T1387A probably benign Het
Scaper A T 9: 55,815,518 probably benign Het
Scara5 A G 14: 65,759,648 E403G possibly damaging Het
Scrib T C 15: 76,067,553 I94V possibly damaging Het
Shank3 T C 15: 89,524,147 F67L possibly damaging Het
Shprh T C 10: 11,207,112 F1562L probably damaging Het
Src C T 2: 157,469,921 T529M probably damaging Het
Sycp2l T A 13: 41,143,466 M341K probably benign Het
Syde1 T C 10: 78,589,095 probably benign Het
Tarsl2 A T 7: 65,678,071 R509S probably damaging Het
Tle6 T A 10: 81,594,346 H324L probably damaging Het
Tnfaip8 ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 18: 50,046,845 probably benign Het
Tnfrsf14 T A 4: 154,925,380 K115* probably null Het
Trappc10 T C 10: 78,201,497 N824S possibly damaging Het
Tsc1 C T 2: 28,671,778 S309F probably damaging Het
Ttc21a A G 9: 119,961,842 I885V possibly damaging Het
Ttn T C 2: 76,948,371 Y1262C unknown Het
Ttn C T 2: 76,740,453 A26699T probably damaging Het
Usp49 T C 17: 47,674,926 probably null Het
Vmn1r226 A T 17: 20,687,871 T122S probably benign Het
Vps8 A T 16: 21,559,337 T1033S probably benign Het
Vwf C A 6: 125,685,837 T2728K probably benign Het
Wdr5b T C 16: 36,041,996 S162P probably benign Het
Xrn1 C T 9: 96,026,877 Q1235* probably null Het
Other mutations in Plppr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01980:Plppr1 APN 4 49319992 missense possibly damaging 0.88
PIT4403001:Plppr1 UTSW 4 49337648 missense probably benign 0.01
R1381:Plppr1 UTSW 4 49337674 missense possibly damaging 0.85
R1452:Plppr1 UTSW 4 49301067 splice site probably benign
R1682:Plppr1 UTSW 4 49325617 critical splice acceptor site probably null
R1980:Plppr1 UTSW 4 49337655 missense probably benign 0.09
R4261:Plppr1 UTSW 4 49300993 missense probably benign 0.09
R4674:Plppr1 UTSW 4 49323384 missense probably damaging 1.00
R5064:Plppr1 UTSW 4 49319974 missense probably benign 0.19
R5144:Plppr1 UTSW 4 49319800 missense possibly damaging 0.71
R7545:Plppr1 UTSW 4 49320002 missense possibly damaging 0.88
R7823:Plppr1 UTSW 4 49325703 missense probably benign 0.01
R8049:Plppr1 UTSW 4 49300942 missense probably benign
Z1177:Plppr1 UTSW 4 49319950 missense probably damaging 1.00
Z1177:Plppr1 UTSW 4 49319995 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CGAACTCATGTTCATTGTCACGGC -3'
(R):5'- GGAATGGCGACTCAGACTGGAATC -3'

Sequencing Primer
(F):5'- Gtctctctctctctctctctctctc -3'
(R):5'- CTGGAATCTGGGAAAGTCAGTG -3'
Posted On2015-02-04