Incidental Mutation 'R0585:Matn3'
ID261951
Institutional Source Beutler Lab
Gene Symbol Matn3
Ensembl Gene ENSMUSG00000020583
Gene Namematrilin 3
Synonyms
MMRRC Submission 038775-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R0585 (G1)
Quality Score73
Status Validated
Chromosome12
Chromosomal Location8947929-8972028 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 8961103 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020899]
Predicted Effect probably benign
Transcript: ENSMUST00000020899
SMART Domains Protein: ENSMUSP00000020899
Gene: ENSMUSG00000020583

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWA 76 255 5.06e-51 SMART
EGF 257 300 2.02e-1 SMART
EGF 304 342 4.1e-2 SMART
EGF 346 384 4.22e-4 SMART
EGF 388 426 1.21e-4 SMART
Matrilin_ccoil 433 479 8.93e-14 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.2%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This protein contains two von Willebrand factor A domains; it is present in the cartilage extracellular matrix and has a role in the development and homeostasis of cartilage and bone. Mutations in this gene result in multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,550,723 V267A probably benign Het
9530003J23Rik T A 10: 117,238,451 I44F possibly damaging Het
Brdt T G 5: 107,356,882 probably null Het
Ccdc162 C T 10: 41,586,379 C1474Y probably benign Het
Ces2e T C 8: 104,929,821 S228P probably damaging Het
Clca1 G T 3: 145,032,625 H41N probably benign Het
Cyp2c39 A T 19: 39,536,759 I169F probably benign Het
Cyp2c65 A G 19: 39,069,242 K107R probably benign Het
Cyp2c67 T A 19: 39,638,694 N231Y possibly damaging Het
Eps8l3 G C 3: 107,881,197 D33H probably damaging Het
Evi5 T C 5: 107,813,536 probably benign Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Gm3993 T A 12: 20,072,148 probably null Het
Gtf2ird1 A C 5: 134,376,942 L28R probably damaging Het
Hsf4 A G 8: 105,271,031 D75G probably damaging Het
Larp4b A G 13: 9,147,493 T249A probably damaging Het
Larp4b A G 13: 9,170,701 D578G probably benign Het
Myo10 T A 15: 25,736,455 Y428N probably damaging Het
Nf1 T A 11: 79,568,701 D661E probably damaging Het
Nktr A G 9: 121,754,280 probably benign Het
Npbwr1 G A 1: 5,916,458 T279I possibly damaging Het
Olfr665 A C 7: 104,881,499 H264P probably damaging Het
Osmr T C 15: 6,837,793 I341V probably benign Het
Pan2 T C 10: 128,310,515 probably null Het
Pknox2 G A 9: 36,909,760 probably benign Het
Pla2g2d A C 4: 138,779,393 D50A probably benign Het
Ptprk C T 10: 28,575,668 L1051F probably damaging Het
Rap1gds1 G A 3: 139,021,872 T59M probably benign Het
Rps5 T C 7: 12,925,405 V41A possibly damaging Het
Ryr1 G T 7: 29,036,076 D4092E probably damaging Het
Spic T C 10: 88,676,043 Y117C probably damaging Het
Thrap3 A T 4: 126,178,574 probably null Het
Tlr9 C T 9: 106,225,076 T522I probably benign Het
Tspan3 A T 9: 56,145,932 probably benign Het
Ttn T C 2: 76,873,159 probably benign Het
Zfp773 T A 7: 7,132,575 I341L probably benign Het
Zmat3 G A 3: 32,361,105 P19S probably damaging Het
Other mutations in Matn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01814:Matn3 APN 12 8952091 missense probably damaging 0.98
IGL02138:Matn3 APN 12 8967638 missense possibly damaging 0.93
IGL02442:Matn3 APN 12 8967678 nonsense probably null
IGL02736:Matn3 APN 12 8955422 missense possibly damaging 0.53
R0091:Matn3 UTSW 12 8952105 missense probably damaging 0.98
R0615:Matn3 UTSW 12 8963594 missense probably damaging 1.00
R1424:Matn3 UTSW 12 8961132 missense possibly damaging 0.91
R1571:Matn3 UTSW 12 8955466 missense probably damaging 1.00
R1844:Matn3 UTSW 12 8967662 missense possibly damaging 0.90
R1865:Matn3 UTSW 12 8952041 missense probably damaging 1.00
R1977:Matn3 UTSW 12 8961110 splice site probably benign
R3015:Matn3 UTSW 12 8952217 missense probably damaging 0.97
R3018:Matn3 UTSW 12 8963578 missense probably benign 0.02
R5180:Matn3 UTSW 12 8955374 missense probably benign 0.38
R5308:Matn3 UTSW 12 8952308 frame shift probably null
R5616:Matn3 UTSW 12 8948195 missense probably benign
R5816:Matn3 UTSW 12 8970571 missense probably damaging 1.00
R5849:Matn3 UTSW 12 8958829 missense probably benign 0.10
R7065:Matn3 UTSW 12 8952472 missense probably damaging 0.99
R7206:Matn3 UTSW 12 8961170 missense probably benign 0.01
RF001:Matn3 UTSW 12 8958797 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGACAGCTTTGCCTAGTCTCCAGC -3'
(R):5'- CTTCACCACCGTGGAAAGAGTCAG -3'

Sequencing Primer
(F):5'- cctggctgtcctggaac -3'
(R):5'- TCAGGTAGGAAAGGATTTGCTG -3'
Posted On2015-02-04