Incidental Mutation 'R0635:Pcm1'
ID 261958
Institutional Source Beutler Lab
Gene Symbol Pcm1
Ensembl Gene ENSMUSG00000031592
Gene Name pericentriolar material 1
Synonyms 9430077F19Rik, C030044G17Rik, 2600002H09Rik
MMRRC Submission 038824-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0635 (G1)
Quality Score 76
Status Validated
Chromosome 8
Chromosomal Location 41692789-41785381 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 41720216 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045218] [ENSMUST00000211247]
AlphaFold Q9R0L6
Predicted Effect probably benign
Transcript: ENSMUST00000045218
SMART Domains Protein: ENSMUSP00000039709
Gene: ENSMUSG00000031592

DomainStartEndE-ValueType
coiled coil region 218 238 N/A INTRINSIC
coiled coil region 270 301 N/A INTRINSIC
coiled coil region 399 426 N/A INTRINSIC
coiled coil region 492 520 N/A INTRINSIC
low complexity region 527 548 N/A INTRINSIC
low complexity region 622 647 N/A INTRINSIC
coiled coil region 652 683 N/A INTRINSIC
coiled coil region 724 772 N/A INTRINSIC
coiled coil region 822 856 N/A INTRINSIC
coiled coil region 988 1017 N/A INTRINSIC
low complexity region 1021 1033 N/A INTRINSIC
low complexity region 1287 1301 N/A INTRINSIC
Pfam:PCM1_C 1369 1999 3.6e-295 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211090
Predicted Effect probably benign
Transcript: ENSMUST00000211247
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of centriolar satellites, which are electron dense granules scattered around centrosomes. Inhibition studies show that this protein is essential for the correct localization of several centrosomal proteins, and for anchoring microtubules to the centrosome. Chromosomal aberrations involving this gene are associated with papillary thyroid carcinomas and a variety of hematological malignancies, including atypical chronic myeloid leukemia and T-cell lymphoma. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
Allele List at MGI

All alleles(34) : Gene trapped(34)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik A T 11: 80,264,891 (GRCm39) probably benign Het
Adamts15 A G 9: 30,816,066 (GRCm39) L631P probably damaging Het
Adamts17 T C 7: 66,558,353 (GRCm39) F266L probably damaging Het
Adgrb1 C A 15: 74,412,741 (GRCm39) Q488K possibly damaging Het
Armh4 A G 14: 50,010,600 (GRCm39) L369S probably benign Het
Cep290 A G 10: 100,328,538 (GRCm39) D109G probably damaging Het
Chil5 A T 3: 105,924,519 (GRCm39) Y229N possibly damaging Het
Cntnap1 A G 11: 101,074,285 (GRCm39) T742A probably benign Het
Col6a3 A T 1: 90,735,808 (GRCm39) probably null Het
Col6a5 G A 9: 105,805,805 (GRCm39) P1034S unknown Het
Daxx T A 17: 34,131,618 (GRCm39) D442E probably benign Het
Dmxl1 T C 18: 49,984,490 (GRCm39) probably benign Het
Dnah11 A G 12: 117,971,731 (GRCm39) F2942S probably damaging Het
Garin4 T C 1: 190,895,924 (GRCm39) T240A probably benign Het
Glg1 A G 8: 111,890,396 (GRCm39) probably benign Het
Gm10272 G A 10: 77,542,535 (GRCm39) probably benign Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,649,766 (GRCm39) noncoding transcript Het
Haao A G 17: 84,146,003 (GRCm39) F83S probably damaging Het
Hdgfl2 T A 17: 56,403,057 (GRCm39) L177Q probably damaging Het
Hrh1 T C 6: 114,457,106 (GRCm39) V129A probably damaging Het
Ift43 T A 12: 86,131,855 (GRCm39) probably benign Het
Il21r T C 7: 125,231,678 (GRCm39) Y369H probably damaging Het
Il2ra C T 2: 11,685,177 (GRCm39) T171M probably benign Het
Lao1 C T 4: 118,825,493 (GRCm39) R438C probably benign Het
Lrrcc1 G A 3: 14,624,288 (GRCm39) S350N probably benign Het
Mageb5 T A X: 90,823,599 (GRCm39) Y260F probably benign Het
Marchf5 A T 19: 37,197,807 (GRCm39) I159F possibly damaging Het
Mgat4a G A 1: 37,491,375 (GRCm39) A282V probably benign Het
Mipep G A 14: 61,066,839 (GRCm39) V420I probably damaging Het
Morc2b A T 17: 33,356,661 (GRCm39) F370L possibly damaging Het
Mt1 A T 8: 94,906,449 (GRCm39) probably null Het
Ncapd2 A G 6: 125,149,999 (GRCm39) V943A probably benign Het
Nkd2 T C 13: 73,975,013 (GRCm39) D58G probably benign Het
Nol8 C G 13: 49,830,234 (GRCm39) S1106C probably benign Het
Nrm C A 17: 36,175,156 (GRCm39) Y61* probably null Het
Nusap1 A G 2: 119,458,148 (GRCm39) T95A probably damaging Het
Ocln T A 13: 100,642,744 (GRCm39) Q197L probably damaging Het
Or5p70 T A 7: 107,994,971 (GRCm39) F215I probably benign Het
Oxtr A G 6: 112,466,161 (GRCm39) Y200H probably damaging Het
Paip2b T C 6: 83,786,891 (GRCm39) E115G possibly damaging Het
Pcnt T C 10: 76,240,419 (GRCm39) D1205G probably damaging Het
Phka1 G A X: 101,665,006 (GRCm39) R186C probably damaging Het
Pik3cb A G 9: 98,946,271 (GRCm39) probably benign Het
Pik3r1 C T 13: 101,893,926 (GRCm39) R81K probably benign Het
Ppa1 A G 10: 61,501,219 (GRCm39) D162G probably benign Het
Ppa1 A G 10: 61,502,749 (GRCm39) R191G probably damaging Het
Ppp4r3c2 T C X: 88,796,128 (GRCm39) probably benign Het
Prss22 T A 17: 24,215,662 (GRCm39) T87S probably benign Het
Rgr T A 14: 36,760,904 (GRCm39) R218* probably null Het
Rreb1 A T 13: 38,125,540 (GRCm39) Q1282L possibly damaging Het
Scel T A 14: 103,820,575 (GRCm39) probably null Het
Sema6b A G 17: 56,436,971 (GRCm39) probably null Het
Slc4a1 T C 11: 102,243,498 (GRCm39) E711G possibly damaging Het
Snx19 C A 9: 30,340,106 (GRCm39) L415M probably damaging Het
Snx19 T G 9: 30,340,107 (GRCm39) L415R probably damaging Het
Specc1 G A 11: 62,009,729 (GRCm39) R495Q probably damaging Het
Tead1 T C 7: 112,490,913 (GRCm39) probably benign Het
Timm10b A C 7: 105,289,895 (GRCm39) probably benign Het
Ubxn7 T A 16: 32,186,235 (GRCm39) probably benign Het
Vmn2r116 T A 17: 23,605,861 (GRCm39) Y258N possibly damaging Het
Vmn2r77 T A 7: 86,460,383 (GRCm39) F570I probably benign Het
Vmn2r98 T C 17: 19,300,759 (GRCm39) V587A probably benign Het
Zfp398 T C 6: 47,840,074 (GRCm39) I101T probably damaging Het
Zfp808 T A 13: 62,320,233 (GRCm39) H487Q probably damaging Het
Other mutations in Pcm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Pcm1 APN 8 41,727,314 (GRCm39) missense probably damaging 1.00
IGL00852:Pcm1 APN 8 41,740,858 (GRCm39) missense probably damaging 1.00
IGL00896:Pcm1 APN 8 41,729,160 (GRCm39) missense possibly damaging 0.70
IGL00927:Pcm1 APN 8 41,740,918 (GRCm39) missense probably damaging 1.00
IGL01085:Pcm1 APN 8 41,762,640 (GRCm39) missense probably damaging 1.00
IGL01684:Pcm1 APN 8 41,710,960 (GRCm39) missense probably benign 0.00
IGL01888:Pcm1 APN 8 41,710,993 (GRCm39) missense probably damaging 0.98
IGL02349:Pcm1 APN 8 41,741,192 (GRCm39) critical splice donor site probably null
IGL02562:Pcm1 APN 8 41,778,405 (GRCm39) missense probably damaging 1.00
IGL02807:Pcm1 APN 8 41,783,919 (GRCm39) missense probably damaging 1.00
IGL03081:Pcm1 APN 8 41,728,097 (GRCm39) missense probably damaging 1.00
R0090_Pcm1_148 UTSW 8 41,709,078 (GRCm39) missense probably damaging 0.99
R1534_pcm1_826 UTSW 8 41,740,738 (GRCm39) missense probably benign
R8169_pcm1_970 UTSW 8 41,763,153 (GRCm39) missense possibly damaging 0.58
shaved UTSW 8 41,741,193 (GRCm39) critical splice donor site probably null
D3080:Pcm1 UTSW 8 41,728,976 (GRCm39) missense probably damaging 1.00
P0045:Pcm1 UTSW 8 41,741,134 (GRCm39) missense probably damaging 0.99
R0090:Pcm1 UTSW 8 41,709,078 (GRCm39) missense probably damaging 0.99
R0109:Pcm1 UTSW 8 41,710,974 (GRCm39) missense possibly damaging 0.88
R0373:Pcm1 UTSW 8 41,729,148 (GRCm39) nonsense probably null
R0386:Pcm1 UTSW 8 41,769,060 (GRCm39) missense probably damaging 1.00
R0452:Pcm1 UTSW 8 41,778,942 (GRCm39) missense probably benign 0.25
R0498:Pcm1 UTSW 8 41,746,806 (GRCm39) missense probably benign 0.01
R0528:Pcm1 UTSW 8 41,768,967 (GRCm39) missense probably damaging 1.00
R0587:Pcm1 UTSW 8 41,739,088 (GRCm39) missense probably damaging 0.99
R0725:Pcm1 UTSW 8 41,740,848 (GRCm39) missense probably damaging 1.00
R0762:Pcm1 UTSW 8 41,714,057 (GRCm39) missense probably damaging 1.00
R0848:Pcm1 UTSW 8 41,735,720 (GRCm39) missense probably damaging 1.00
R1027:Pcm1 UTSW 8 41,746,482 (GRCm39) splice site probably benign
R1056:Pcm1 UTSW 8 41,774,937 (GRCm39) missense probably damaging 1.00
R1534:Pcm1 UTSW 8 41,740,738 (GRCm39) missense probably benign
R1566:Pcm1 UTSW 8 41,743,810 (GRCm39) missense probably damaging 1.00
R1595:Pcm1 UTSW 8 41,762,672 (GRCm39) missense probably damaging 1.00
R1719:Pcm1 UTSW 8 41,766,396 (GRCm39) missense possibly damaging 0.62
R1816:Pcm1 UTSW 8 41,762,574 (GRCm39) missense probably damaging 0.99
R2177:Pcm1 UTSW 8 41,729,002 (GRCm39) missense probably benign
R2495:Pcm1 UTSW 8 41,746,616 (GRCm39) missense probably benign
R3737:Pcm1 UTSW 8 41,714,080 (GRCm39) nonsense probably null
R3747:Pcm1 UTSW 8 41,785,041 (GRCm39) missense probably benign 0.44
R3763:Pcm1 UTSW 8 41,733,114 (GRCm39) missense probably damaging 1.00
R3764:Pcm1 UTSW 8 41,783,919 (GRCm39) missense probably damaging 1.00
R3798:Pcm1 UTSW 8 41,711,051 (GRCm39) missense possibly damaging 0.66
R3968:Pcm1 UTSW 8 41,778,867 (GRCm39) missense probably damaging 1.00
R4760:Pcm1 UTSW 8 41,740,775 (GRCm39) missense probably damaging 0.99
R4798:Pcm1 UTSW 8 41,746,715 (GRCm39) missense probably damaging 1.00
R5062:Pcm1 UTSW 8 41,712,297 (GRCm39) missense probably damaging 0.99
R5221:Pcm1 UTSW 8 41,741,193 (GRCm39) critical splice donor site probably null
R5250:Pcm1 UTSW 8 41,765,242 (GRCm39) missense probably damaging 0.99
R5466:Pcm1 UTSW 8 41,725,499 (GRCm39) critical splice donor site probably null
R5470:Pcm1 UTSW 8 41,740,720 (GRCm39) missense probably damaging 1.00
R5958:Pcm1 UTSW 8 41,782,016 (GRCm39) missense probably damaging 1.00
R6043:Pcm1 UTSW 8 41,781,815 (GRCm39) missense possibly damaging 0.54
R6179:Pcm1 UTSW 8 41,736,669 (GRCm39) missense probably damaging 0.99
R6186:Pcm1 UTSW 8 41,746,830 (GRCm39) missense probably benign 0.23
R6227:Pcm1 UTSW 8 41,783,862 (GRCm39) missense probably damaging 0.99
R6368:Pcm1 UTSW 8 41,746,581 (GRCm39) missense probably benign 0.09
R6438:Pcm1 UTSW 8 41,778,418 (GRCm39) missense possibly damaging 0.94
R6459:Pcm1 UTSW 8 41,714,073 (GRCm39) missense probably damaging 1.00
R7399:Pcm1 UTSW 8 41,746,547 (GRCm39) missense probably benign 0.11
R7401:Pcm1 UTSW 8 41,762,568 (GRCm39) missense probably damaging 1.00
R7478:Pcm1 UTSW 8 41,714,410 (GRCm39) missense probably benign 0.17
R7570:Pcm1 UTSW 8 41,720,381 (GRCm39) missense possibly damaging 0.64
R7648:Pcm1 UTSW 8 41,728,736 (GRCm39) missense probably damaging 0.99
R7773:Pcm1 UTSW 8 41,762,610 (GRCm39) nonsense probably null
R7779:Pcm1 UTSW 8 41,782,061 (GRCm39) missense probably damaging 1.00
R7842:Pcm1 UTSW 8 41,780,621 (GRCm39) missense possibly damaging 0.54
R7863:Pcm1 UTSW 8 41,714,163 (GRCm39) missense probably damaging 0.99
R8169:Pcm1 UTSW 8 41,763,153 (GRCm39) missense possibly damaging 0.58
R8210:Pcm1 UTSW 8 41,766,974 (GRCm39) missense probably damaging 1.00
R8303:Pcm1 UTSW 8 41,736,758 (GRCm39) missense probably damaging 1.00
R8397:Pcm1 UTSW 8 41,736,616 (GRCm39) missense probably damaging 1.00
R8489:Pcm1 UTSW 8 41,766,437 (GRCm39) missense probably benign 0.19
R8519:Pcm1 UTSW 8 41,728,976 (GRCm39) missense probably damaging 1.00
R9136:Pcm1 UTSW 8 41,732,825 (GRCm39) missense probably benign 0.19
R9245:Pcm1 UTSW 8 41,732,877 (GRCm39) missense probably damaging 0.99
R9263:Pcm1 UTSW 8 41,732,790 (GRCm39) missense probably benign 0.00
R9406:Pcm1 UTSW 8 41,728,722 (GRCm39) missense probably damaging 0.99
R9412:Pcm1 UTSW 8 41,740,788 (GRCm39) missense probably damaging 1.00
R9541:Pcm1 UTSW 8 41,780,616 (GRCm39) missense probably benign 0.09
R9698:Pcm1 UTSW 8 41,723,541 (GRCm39) missense possibly damaging 0.95
R9716:Pcm1 UTSW 8 41,728,168 (GRCm39) missense probably damaging 0.98
R9747:Pcm1 UTSW 8 41,757,135 (GRCm39) missense probably benign 0.00
R9781:Pcm1 UTSW 8 41,720,398 (GRCm39) missense probably damaging 0.99
X0025:Pcm1 UTSW 8 41,783,679 (GRCm39) missense probably damaging 1.00
Z1177:Pcm1 UTSW 8 41,740,781 (GRCm39) missense probably damaging 0.99
Z1177:Pcm1 UTSW 8 41,727,208 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGCCCCAAACTCAGCTAAATGGATG -3'
(R):5'- TATGCTGCAAAGCTAGAAGAGCAGCC -3'

Sequencing Primer
(F):5'- GCAGTATGTATAGCTCCATTTGCC -3'
(R):5'- CTAGAAGAGCAGCCTGTCG -3'
Posted On 2015-02-04