Incidental Mutation 'R0335:Cnot1'
ID26196
Institutional Source Beutler Lab
Gene Symbol Cnot1
Ensembl Gene ENSMUSG00000036550
Gene NameCCR4-NOT transcription complex, subunit 1
Synonyms6030411K04Rik
MMRRC Submission 038544-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0335 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location95719451-95807464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95772000 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 203 (I203K)
Ref Sequence ENSEMBL: ENSMUSP00000148735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000212323] [ENSMUST00000213006] [ENSMUST00000213046]
Predicted Effect probably benign
Transcript: ENSMUST00000068452
AA Change: I203K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: I203K

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
PDB:4J8S|A 798 999 1e-137 PDB
low complexity region 1011 1028 N/A INTRINSIC
low complexity region 1031 1055 N/A INTRINSIC
PDB:4CT4|C 1056 1295 1e-148 PDB
low complexity region 1296 1308 N/A INTRINSIC
low complexity region 1328 1345 N/A INTRINSIC
Pfam:DUF3819 1381 1530 2.5e-56 PFAM
low complexity region 1634 1648 N/A INTRINSIC
Pfam:Not1 1991 2305 2.4e-125 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098473
AA Change: I203K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: I203K

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
Pfam:CNOT1_HEAT 500 656 2.4e-57 PFAM
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
Pfam:CNOT1_TTP_bind 812 1004 1.4e-87 PFAM
low complexity region 1016 1033 N/A INTRINSIC
low complexity region 1036 1060 N/A INTRINSIC
Pfam:CNOT1_CAF1_bind 1087 1313 5.7e-99 PFAM
low complexity region 1333 1350 N/A INTRINSIC
Pfam:DUF3819 1387 1534 2.3e-57 PFAM
low complexity region 1639 1653 N/A INTRINSIC
Pfam:Not1 1998 2357 5.7e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211887
AA Change: I201K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212228
Predicted Effect probably benign
Transcript: ENSMUST00000212323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212863
Predicted Effect probably benign
Transcript: ENSMUST00000213006
AA Change: I203K

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000213046
Meta Mutation Damage Score 0.2333 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.6%
  • 20x: 87.5%
Validation Efficiency 100% (89/89)
MGI Phenotype PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830406C13Rik A G 14: 12,301,266 E124G possibly damaging Het
4932438A13Rik T C 3: 36,969,152 V2210A probably damaging Het
Adamts12 G T 15: 11,311,058 D1134Y possibly damaging Het
Add3 A G 19: 53,236,828 T460A probably benign Het
Amer3 A C 1: 34,579,300 probably benign Het
Arhgap22 C T 14: 33,359,108 probably benign Het
Arhgap32 T G 9: 32,259,760 S1279A probably benign Het
Bcas1 G A 2: 170,418,681 T26M probably damaging Het
Begain A T 12: 109,038,934 F256I probably damaging Het
Cabin1 A T 10: 75,657,049 I1804N probably damaging Het
Cad G A 5: 31,073,985 probably benign Het
Carmil1 G A 13: 24,073,983 S762L probably damaging Het
Ccdc93 T A 1: 121,492,977 L529Q probably damaging Het
Cdh12 T A 15: 21,578,549 probably null Het
Clip2 T A 5: 134,535,215 probably benign Het
Cmip T C 8: 117,445,366 I480T probably damaging Het
Col18a1 G A 10: 77,059,363 P1155S probably damaging Het
Col1a2 T A 6: 4,531,956 probably benign Het
Crybg3 A T 16: 59,544,140 L2373Q probably damaging Het
D130043K22Rik A T 13: 24,887,877 I935F probably damaging Het
Dapl1 T A 2: 59,496,594 D61E possibly damaging Het
Def6 A G 17: 28,228,069 D558G possibly damaging Het
Dnah6 T C 6: 73,069,399 probably benign Het
Dvl2 G A 11: 70,001,035 probably benign Het
Ecd A C 14: 20,320,734 V639G probably benign Het
Epg5 C T 18: 77,986,472 T1350M probably benign Het
Erbb4 C A 1: 68,259,259 M657I probably benign Het
Evi5 T C 5: 107,812,411 R431G probably benign Het
Fbxo11 G A 17: 88,015,613 A115V possibly damaging Het
Fgfr2 T C 7: 130,196,249 T192A probably benign Het
Gas7 C T 11: 67,662,052 A146V possibly damaging Het
Gatad2b T A 3: 90,356,182 S529T probably benign Het
Gm10722 G T 9: 3,001,048 Q41H probably null Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm7535 A G 17: 17,911,112 probably benign Het
Gstm1 T A 3: 108,012,696 N193I possibly damaging Het
Heatr5b G A 17: 78,827,946 P252L probably benign Het
Hmgb1 A G 5: 149,050,631 V36A probably benign Het
Hrh1 G T 6: 114,480,232 W158L probably damaging Het
Ighv6-4 T C 12: 114,406,674 M53V probably benign Het
Iqgap2 T A 13: 95,635,633 D1346V probably damaging Het
Kcng3 A T 17: 83,587,737 N433K possibly damaging Het
Kif1a T A 1: 93,052,566 probably benign Het
Lctl C A 9: 64,118,887 Q75K probably benign Het
Ldb3 T A 14: 34,578,651 I89F possibly damaging Het
Lrrc49 A T 9: 60,677,095 L156Q probably damaging Het
Mark2 G T 19: 7,281,828 T83K probably benign Het
Ms4a15 A T 19: 10,980,210 D170E probably damaging Het
Msantd2 A G 9: 37,522,760 S99G possibly damaging Het
Nemf G T 12: 69,353,803 T124N probably benign Het
Nlrp9c A T 7: 26,394,136 F35I possibly damaging Het
Nwd2 A G 5: 63,804,773 I567V probably benign Het
Olfr111 A C 17: 37,530,642 I222L probably benign Het
Olfr1340 A G 4: 118,727,170 I308V probably null Het
Olfr323 T C 11: 58,625,740 Y102C probably damaging Het
Olfr828 T A 9: 18,815,994 Q100L probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pdk4 T C 6: 5,491,138 E209G probably benign Het
Plch1 T C 3: 63,710,978 Q712R probably damaging Het
Pnpla1 T A 17: 28,886,878 V569E possibly damaging Het
Prkar2a A T 9: 108,719,258 D134V probably damaging Het
Ptov1 T A 7: 44,864,622 Q40L possibly damaging Het
Ptprq T C 10: 107,708,728 I314V probably benign Het
Rabl2 T C 15: 89,583,966 K66E probably damaging Het
Rnf38 A G 4: 44,152,507 V19A possibly damaging Het
Scn2a T A 2: 65,682,091 W191R probably damaging Het
Sec22b T A 3: 97,921,256 F212I possibly damaging Het
Sec24c T A 14: 20,688,715 probably null Het
Sept2 T C 1: 93,495,599 S51P probably damaging Het
Serpinb1a T C 13: 32,848,656 N90S probably damaging Het
Slc1a2 C T 2: 102,743,863 T206I probably benign Het
Slc25a19 C A 11: 115,624,206 R42L probably damaging Het
St14 G A 9: 31,091,324 probably benign Het
Stxbp1 C T 2: 32,802,905 probably benign Het
Tas2r131 C T 6: 132,957,829 V6I probably benign Het
Tdo2 T A 3: 81,964,000 M235L probably benign Het
Tenm3 T G 8: 48,232,105 H2432P probably damaging Het
Tmprss15 C T 16: 79,024,742 probably benign Het
Tmx1 A G 12: 70,453,256 N30D probably benign Het
Tom1 A G 8: 75,064,392 probably null Het
Top2a T C 11: 99,022,955 N20S probably benign Het
Ttc23l T A 15: 10,539,963 T145S probably benign Het
Unc13b T A 4: 43,236,983 M3351K possibly damaging Het
Vmn1r47 T C 6: 90,022,659 S258P probably damaging Het
Vmn2r8 T G 5: 108,797,451 probably null Het
Vps11 T C 9: 44,353,838 Q641R probably null Het
Wapl T A 14: 34,692,324 I381N probably damaging Het
Zmym6 G A 4: 127,122,808 G794E probably damaging Het
Other mutations in Cnot1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cnot1 APN 8 95726079 missense probably damaging 1.00
IGL01340:Cnot1 APN 8 95760537 missense probably damaging 1.00
IGL01457:Cnot1 APN 8 95741009 missense probably damaging 1.00
IGL01505:Cnot1 APN 8 95728718 missense probably damaging 0.98
IGL02401:Cnot1 APN 8 95756133 missense possibly damaging 0.95
IGL02693:Cnot1 APN 8 95773485 missense probably damaging 1.00
IGL02696:Cnot1 APN 8 95745017 missense probably benign 0.00
IGL02754:Cnot1 APN 8 95755078 missense probably benign 0.03
IGL03092:Cnot1 APN 8 95769615 intron probably benign
IGL03174:Cnot1 APN 8 95761355 missense probably damaging 1.00
IGL03310:Cnot1 APN 8 95735680 splice site probably benign
IGL03371:Cnot1 APN 8 95774716 missense possibly damaging 0.85
barge UTSW 8 95734129 missense probably benign 0.13
kowloon UTSW 8 95788658 missense probably damaging 1.00
tugboat UTSW 8 95773618 missense probably damaging 0.99
Xiao UTSW 8 95730420 missense probably damaging 1.00
BB001:Cnot1 UTSW 8 95745647 frame shift probably null
BB003:Cnot1 UTSW 8 95745647 frame shift probably null
BB011:Cnot1 UTSW 8 95745647 frame shift probably null
BB013:Cnot1 UTSW 8 95745647 frame shift probably null
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0091:Cnot1 UTSW 8 95763144 missense probably damaging 1.00
R0409:Cnot1 UTSW 8 95748855 missense probably damaging 0.96
R0445:Cnot1 UTSW 8 95760208 missense probably damaging 1.00
R1505:Cnot1 UTSW 8 95728667 missense probably damaging 1.00
R1517:Cnot1 UTSW 8 95743213 missense probably benign 0.38
R1640:Cnot1 UTSW 8 95769832 missense probably damaging 0.98
R1737:Cnot1 UTSW 8 95748276 missense probably damaging 0.98
R1755:Cnot1 UTSW 8 95724577 missense probably damaging 1.00
R1901:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1902:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1903:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1988:Cnot1 UTSW 8 95741944 missense possibly damaging 0.89
R2051:Cnot1 UTSW 8 95724593 missense possibly damaging 0.47
R2054:Cnot1 UTSW 8 95739841 missense possibly damaging 0.55
R2072:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2074:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2075:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2093:Cnot1 UTSW 8 95775358 missense probably damaging 1.00
R2116:Cnot1 UTSW 8 95726153 missense probably damaging 1.00
R2191:Cnot1 UTSW 8 95761426 missense probably damaging 0.98
R2238:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2239:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2251:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2252:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2253:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2315:Cnot1 UTSW 8 95749062 missense probably damaging 1.00
R2431:Cnot1 UTSW 8 95774652 missense probably damaging 1.00
R2988:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R2989:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3108:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3109:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3114:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3115:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3153:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3154:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R4112:Cnot1 UTSW 8 95773618 missense probably damaging 0.99
R4359:Cnot1 UTSW 8 95739848 missense probably damaging 1.00
R4382:Cnot1 UTSW 8 95769779 missense probably damaging 0.97
R4747:Cnot1 UTSW 8 95774682 missense probably benign 0.27
R4910:Cnot1 UTSW 8 95733231 missense probably benign 0.43
R4913:Cnot1 UTSW 8 95763067 missense possibly damaging 0.63
R4971:Cnot1 UTSW 8 95721626 missense probably damaging 1.00
R5056:Cnot1 UTSW 8 95741008 missense probably damaging 1.00
R5092:Cnot1 UTSW 8 95752768 missense possibly damaging 0.91
R5101:Cnot1 UTSW 8 95760187 missense possibly damaging 0.90
R5498:Cnot1 UTSW 8 95757355 missense possibly damaging 0.92
R5719:Cnot1 UTSW 8 95744296 missense possibly damaging 0.92
R5850:Cnot1 UTSW 8 95734147 nonsense probably null
R5956:Cnot1 UTSW 8 95754978 critical splice donor site probably null
R5981:Cnot1 UTSW 8 95788665 missense probably damaging 1.00
R6093:Cnot1 UTSW 8 95748894 missense probably benign 0.03
R6108:Cnot1 UTSW 8 95730420 missense probably damaging 1.00
R6261:Cnot1 UTSW 8 95741921 missense probably benign 0.00
R6632:Cnot1 UTSW 8 95773267 intron probably benign
R6882:Cnot1 UTSW 8 95720426 missense possibly damaging 0.85
R6966:Cnot1 UTSW 8 95724532 missense probably damaging 1.00
R6985:Cnot1 UTSW 8 95734129 missense probably benign 0.13
R7210:Cnot1 UTSW 8 95788658 missense probably damaging 1.00
R7410:Cnot1 UTSW 8 95733159 missense possibly damaging 0.77
R7623:Cnot1 UTSW 8 95727648 missense probably damaging 1.00
R7624:Cnot1 UTSW 8 95751819 missense probably damaging 1.00
R7695:Cnot1 UTSW 8 95770632 missense probably benign 0.03
R7703:Cnot1 UTSW 8 95760098 critical splice donor site probably null
R7771:Cnot1 UTSW 8 95765125 missense probably damaging 0.99
R7800:Cnot1 UTSW 8 95765062 missense probably benign 0.15
R7809:Cnot1 UTSW 8 95751778 missense probably damaging 1.00
R7857:Cnot1 UTSW 8 95745647 frame shift probably null
R7924:Cnot1 UTSW 8 95745647 frame shift probably null
R7926:Cnot1 UTSW 8 95745647 frame shift probably null
R8004:Cnot1 UTSW 8 95752752 missense probably benign 0.03
R8061:Cnot1 UTSW 8 95765027 missense possibly damaging 0.95
R8185:Cnot1 UTSW 8 95761351 missense probably damaging 1.00
R8269:Cnot1 UTSW 8 95751761 missense probably damaging 1.00
R8306:Cnot1 UTSW 8 95747021 missense probably benign 0.05
R8322:Cnot1 UTSW 8 95769844 missense probably benign 0.00
X0050:Cnot1 UTSW 8 95743098 splice site probably null
Z1176:Cnot1 UTSW 8 95748277 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- AGCAAAGAGCATTGCCTACTCTCAC -3'
(R):5'- TCCCGTTCATCAGTCACTGTCTAAGTAA -3'

Sequencing Primer
(F):5'- AGCATTGCCTACTCTCACAGATG -3'
(R):5'- GCAAAGTGAATTATGGTGCATAC -3'
Posted On2013-04-16