Incidental Mutation 'R0335:Cnot1'
ID 26196
Institutional Source Beutler Lab
Gene Symbol Cnot1
Ensembl Gene ENSMUSG00000036550
Gene Name CCR4-NOT transcription complex, subunit 1
Synonyms 6030411K04Rik
MMRRC Submission 038544-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0335 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 96446079-96534092 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 96498628 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 203 (I203K)
Ref Sequence ENSEMBL: ENSMUSP00000148735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000212323] [ENSMUST00000213006] [ENSMUST00000213046]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000068452
AA Change: I203K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: I203K

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
PDB:4J8S|A 798 999 1e-137 PDB
low complexity region 1011 1028 N/A INTRINSIC
low complexity region 1031 1055 N/A INTRINSIC
PDB:4CT4|C 1056 1295 1e-148 PDB
low complexity region 1296 1308 N/A INTRINSIC
low complexity region 1328 1345 N/A INTRINSIC
Pfam:DUF3819 1381 1530 2.5e-56 PFAM
low complexity region 1634 1648 N/A INTRINSIC
Pfam:Not1 1991 2305 2.4e-125 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098473
AA Change: I203K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: I203K

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
Pfam:CNOT1_HEAT 500 656 2.4e-57 PFAM
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
Pfam:CNOT1_TTP_bind 812 1004 1.4e-87 PFAM
low complexity region 1016 1033 N/A INTRINSIC
low complexity region 1036 1060 N/A INTRINSIC
Pfam:CNOT1_CAF1_bind 1087 1313 5.7e-99 PFAM
low complexity region 1333 1350 N/A INTRINSIC
Pfam:DUF3819 1387 1534 2.3e-57 PFAM
low complexity region 1639 1653 N/A INTRINSIC
Pfam:Not1 1998 2357 5.7e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211887
AA Change: I201K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212228
Predicted Effect probably benign
Transcript: ENSMUST00000212323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212863
Predicted Effect probably benign
Transcript: ENSMUST00000213006
AA Change: I203K

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000213046
Meta Mutation Damage Score 0.2333 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.6%
  • 20x: 87.5%
Validation Efficiency 100% (89/89)
MGI Phenotype PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 G T 15: 11,311,144 (GRCm39) D1134Y possibly damaging Het
Add3 A G 19: 53,225,259 (GRCm39) T460A probably benign Het
Amer3 A C 1: 34,618,381 (GRCm39) probably benign Het
Arhgap22 C T 14: 33,081,065 (GRCm39) probably benign Het
Arhgap32 T G 9: 32,171,056 (GRCm39) S1279A probably benign Het
Bcas1 G A 2: 170,260,601 (GRCm39) T26M probably damaging Het
Begain A T 12: 109,004,860 (GRCm39) F256I probably damaging Het
Bltp1 T C 3: 37,023,301 (GRCm39) V2210A probably damaging Het
Cabin1 A T 10: 75,492,883 (GRCm39) I1804N probably damaging Het
Cad G A 5: 31,231,329 (GRCm39) probably benign Het
Carmil1 G A 13: 24,257,966 (GRCm39) S762L probably damaging Het
Ccdc93 T A 1: 121,420,706 (GRCm39) L529Q probably damaging Het
Cdh12 T A 15: 21,578,635 (GRCm39) probably null Het
Cep15 A G 14: 12,301,266 (GRCm38) E124G possibly damaging Het
Clip2 T A 5: 134,564,069 (GRCm39) probably benign Het
Cmip T C 8: 118,172,105 (GRCm39) I480T probably damaging Het
Col18a1 G A 10: 76,895,197 (GRCm39) P1155S probably damaging Het
Col1a2 T A 6: 4,531,956 (GRCm39) probably benign Het
Crybg3 A T 16: 59,364,503 (GRCm39) L2373Q probably damaging Het
D130043K22Rik A T 13: 25,071,860 (GRCm39) I935F probably damaging Het
Dapl1 T A 2: 59,326,938 (GRCm39) D61E possibly damaging Het
Def6 A G 17: 28,447,043 (GRCm39) D558G possibly damaging Het
Dnah6 T C 6: 73,046,382 (GRCm39) probably benign Het
Dvl2 G A 11: 69,891,861 (GRCm39) probably benign Het
Ecd A C 14: 20,370,802 (GRCm39) V639G probably benign Het
Epg5 C T 18: 78,029,687 (GRCm39) T1350M probably benign Het
Erbb4 C A 1: 68,298,418 (GRCm39) M657I probably benign Het
Evi5 T C 5: 107,960,277 (GRCm39) R431G probably benign Het
Fbxo11 G A 17: 88,323,041 (GRCm39) A115V possibly damaging Het
Fgfr2 T C 7: 129,797,979 (GRCm39) T192A probably benign Het
Gas7 C T 11: 67,552,878 (GRCm39) A146V possibly damaging Het
Gatad2b T A 3: 90,263,489 (GRCm39) S529T probably benign Het
Gm10722 G T 9: 3,001,048 (GRCm39) Q41H probably null Het
Gm10801 G C 2: 98,494,352 (GRCm39) R143T possibly damaging Het
Gm7535 A G 17: 18,131,374 (GRCm39) probably benign Het
Gstm1 T A 3: 107,920,012 (GRCm39) N193I possibly damaging Het
Heatr5b G A 17: 79,135,375 (GRCm39) P252L probably benign Het
Hmgb1 A G 5: 148,987,441 (GRCm39) V36A probably benign Het
Hrh1 G T 6: 114,457,193 (GRCm39) W158L probably damaging Het
Ighv6-4 T C 12: 114,370,294 (GRCm39) M53V probably benign Het
Iqgap2 T A 13: 95,772,141 (GRCm39) D1346V probably damaging Het
Kcng3 A T 17: 83,895,166 (GRCm39) N433K possibly damaging Het
Kif1a T A 1: 92,980,288 (GRCm39) probably benign Het
Lctl C A 9: 64,026,169 (GRCm39) Q75K probably benign Het
Ldb3 T A 14: 34,300,608 (GRCm39) I89F possibly damaging Het
Lrrc49 A T 9: 60,584,378 (GRCm39) L156Q probably damaging Het
Mark2 G T 19: 7,259,193 (GRCm39) T83K probably benign Het
Ms4a15 A T 19: 10,957,574 (GRCm39) D170E probably damaging Het
Msantd2 A G 9: 37,434,056 (GRCm39) S99G possibly damaging Het
Nemf G T 12: 69,400,577 (GRCm39) T124N probably benign Het
Nlrp9c A T 7: 26,093,561 (GRCm39) F35I possibly damaging Het
Nwd2 A G 5: 63,962,116 (GRCm39) I567V probably benign Het
Optn C T 2: 5,028,926 (GRCm39) G526R probably damaging Het
Or11l3 T C 11: 58,516,566 (GRCm39) Y102C probably damaging Het
Or13p8 A G 4: 118,584,367 (GRCm39) I308V probably null Het
Or5v1b A C 17: 37,841,533 (GRCm39) I222L probably benign Het
Or7g16 T A 9: 18,727,290 (GRCm39) Q100L probably damaging Het
Pdk4 T C 6: 5,491,138 (GRCm39) E209G probably benign Het
Plch1 T C 3: 63,618,399 (GRCm39) Q712R probably damaging Het
Pnpla1 T A 17: 29,105,852 (GRCm39) V569E possibly damaging Het
Prkar2a A T 9: 108,596,457 (GRCm39) D134V probably damaging Het
Ptov1 T A 7: 44,514,046 (GRCm39) Q40L possibly damaging Het
Ptprq T C 10: 107,544,589 (GRCm39) I314V probably benign Het
Rabl2 T C 15: 89,468,169 (GRCm39) K66E probably damaging Het
Rnf38 A G 4: 44,152,507 (GRCm39) V19A possibly damaging Het
Scn2a T A 2: 65,512,435 (GRCm39) W191R probably damaging Het
Sec22b T A 3: 97,828,572 (GRCm39) F212I possibly damaging Het
Sec24c T A 14: 20,738,783 (GRCm39) probably null Het
Septin2 T C 1: 93,423,321 (GRCm39) S51P probably damaging Het
Serpinb1a T C 13: 33,032,639 (GRCm39) N90S probably damaging Het
Slc1a2 C T 2: 102,574,208 (GRCm39) T206I probably benign Het
Slc25a19 C A 11: 115,515,032 (GRCm39) R42L probably damaging Het
St14 G A 9: 31,002,620 (GRCm39) probably benign Het
Stxbp1 C T 2: 32,692,917 (GRCm39) probably benign Het
Tas2r131 C T 6: 132,934,792 (GRCm39) V6I probably benign Het
Tdo2 T A 3: 81,871,307 (GRCm39) M235L probably benign Het
Tenm3 T G 8: 48,685,140 (GRCm39) H2432P probably damaging Het
Tmprss15 C T 16: 78,821,630 (GRCm39) probably benign Het
Tmx1 A G 12: 70,500,030 (GRCm39) N30D probably benign Het
Tom1 A G 8: 75,791,020 (GRCm39) probably null Het
Top2a T C 11: 98,913,781 (GRCm39) N20S probably benign Het
Ttc23l T A 15: 10,540,049 (GRCm39) T145S probably benign Het
Unc13b T A 4: 43,236,983 (GRCm39) M3351K possibly damaging Het
Vmn1r47 T C 6: 89,999,641 (GRCm39) S258P probably damaging Het
Vmn2r8 T G 5: 108,945,317 (GRCm39) probably null Het
Vps11 T C 9: 44,265,135 (GRCm39) Q641R probably null Het
Wapl T A 14: 34,414,281 (GRCm39) I381N probably damaging Het
Zmym6 G A 4: 127,016,601 (GRCm39) G794E probably damaging Het
Other mutations in Cnot1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cnot1 APN 8 96,452,707 (GRCm39) missense probably damaging 1.00
IGL01340:Cnot1 APN 8 96,487,165 (GRCm39) missense probably damaging 1.00
IGL01457:Cnot1 APN 8 96,467,637 (GRCm39) missense probably damaging 1.00
IGL01505:Cnot1 APN 8 96,455,346 (GRCm39) missense probably damaging 0.98
IGL02401:Cnot1 APN 8 96,482,761 (GRCm39) missense possibly damaging 0.95
IGL02693:Cnot1 APN 8 96,500,113 (GRCm39) missense probably damaging 1.00
IGL02696:Cnot1 APN 8 96,471,645 (GRCm39) missense probably benign 0.00
IGL02754:Cnot1 APN 8 96,481,706 (GRCm39) missense probably benign 0.03
IGL03092:Cnot1 APN 8 96,496,243 (GRCm39) intron probably benign
IGL03174:Cnot1 APN 8 96,487,983 (GRCm39) missense probably damaging 1.00
IGL03310:Cnot1 APN 8 96,462,308 (GRCm39) splice site probably benign
IGL03371:Cnot1 APN 8 96,501,344 (GRCm39) missense possibly damaging 0.85
Affiliate UTSW 8 96,491,753 (GRCm39) missense probably damaging 0.99
Barge UTSW 8 96,460,757 (GRCm39) missense probably benign 0.13
Byproduct UTSW 8 96,472,275 (GRCm39) frame shift probably null
Chairman UTSW 8 96,491,655 (GRCm39) missense possibly damaging 0.95
cohort UTSW 8 96,462,377 (GRCm39) missense probably damaging 0.99
Director UTSW 8 96,491,690 (GRCm39) missense probably benign 0.15
kowloon UTSW 8 96,515,286 (GRCm39) missense probably damaging 1.00
Quorum UTSW 8 96,452,746 (GRCm39) missense probably damaging 1.00
tugboat UTSW 8 96,500,246 (GRCm39) missense probably damaging 0.99
Xiao UTSW 8 96,457,048 (GRCm39) missense probably damaging 1.00
BB001:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
BB003:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
BB011:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
BB013:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
R0008:Cnot1 UTSW 8 96,487,969 (GRCm39) missense probably damaging 1.00
R0008:Cnot1 UTSW 8 96,487,969 (GRCm39) missense probably damaging 1.00
R0091:Cnot1 UTSW 8 96,489,772 (GRCm39) missense probably damaging 1.00
R0409:Cnot1 UTSW 8 96,475,483 (GRCm39) missense probably damaging 0.96
R0445:Cnot1 UTSW 8 96,486,836 (GRCm39) missense probably damaging 1.00
R1505:Cnot1 UTSW 8 96,455,295 (GRCm39) missense probably damaging 1.00
R1517:Cnot1 UTSW 8 96,469,841 (GRCm39) missense probably benign 0.38
R1640:Cnot1 UTSW 8 96,496,460 (GRCm39) missense probably damaging 0.98
R1737:Cnot1 UTSW 8 96,474,904 (GRCm39) missense probably damaging 0.98
R1755:Cnot1 UTSW 8 96,451,205 (GRCm39) missense probably damaging 1.00
R1901:Cnot1 UTSW 8 96,469,749 (GRCm39) missense possibly damaging 0.50
R1902:Cnot1 UTSW 8 96,469,749 (GRCm39) missense possibly damaging 0.50
R1903:Cnot1 UTSW 8 96,469,749 (GRCm39) missense possibly damaging 0.50
R1988:Cnot1 UTSW 8 96,468,572 (GRCm39) missense possibly damaging 0.89
R2051:Cnot1 UTSW 8 96,451,221 (GRCm39) missense possibly damaging 0.47
R2054:Cnot1 UTSW 8 96,466,469 (GRCm39) missense possibly damaging 0.55
R2072:Cnot1 UTSW 8 96,466,461 (GRCm39) missense possibly damaging 0.89
R2074:Cnot1 UTSW 8 96,466,461 (GRCm39) missense possibly damaging 0.89
R2075:Cnot1 UTSW 8 96,466,461 (GRCm39) missense possibly damaging 0.89
R2093:Cnot1 UTSW 8 96,501,986 (GRCm39) missense probably damaging 1.00
R2116:Cnot1 UTSW 8 96,452,781 (GRCm39) missense probably damaging 1.00
R2191:Cnot1 UTSW 8 96,488,054 (GRCm39) missense probably damaging 0.98
R2238:Cnot1 UTSW 8 96,496,149 (GRCm39) missense probably benign 0.04
R2239:Cnot1 UTSW 8 96,496,149 (GRCm39) missense probably benign 0.04
R2251:Cnot1 UTSW 8 96,489,814 (GRCm39) missense probably benign 0.00
R2252:Cnot1 UTSW 8 96,489,814 (GRCm39) missense probably benign 0.00
R2253:Cnot1 UTSW 8 96,489,814 (GRCm39) missense probably benign 0.00
R2315:Cnot1 UTSW 8 96,475,690 (GRCm39) missense probably damaging 1.00
R2431:Cnot1 UTSW 8 96,501,280 (GRCm39) missense probably damaging 1.00
R2988:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R2989:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R3108:Cnot1 UTSW 8 96,462,377 (GRCm39) missense probably damaging 0.99
R3109:Cnot1 UTSW 8 96,462,377 (GRCm39) missense probably damaging 0.99
R3114:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R3115:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R3153:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R3154:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R4112:Cnot1 UTSW 8 96,500,246 (GRCm39) missense probably damaging 0.99
R4359:Cnot1 UTSW 8 96,466,476 (GRCm39) missense probably damaging 1.00
R4382:Cnot1 UTSW 8 96,496,407 (GRCm39) missense probably damaging 0.97
R4747:Cnot1 UTSW 8 96,501,310 (GRCm39) missense probably benign 0.27
R4910:Cnot1 UTSW 8 96,459,859 (GRCm39) missense probably benign 0.43
R4913:Cnot1 UTSW 8 96,489,695 (GRCm39) missense possibly damaging 0.63
R4971:Cnot1 UTSW 8 96,448,254 (GRCm39) missense probably damaging 1.00
R5056:Cnot1 UTSW 8 96,467,636 (GRCm39) missense probably damaging 1.00
R5092:Cnot1 UTSW 8 96,479,396 (GRCm39) missense possibly damaging 0.91
R5101:Cnot1 UTSW 8 96,486,815 (GRCm39) missense possibly damaging 0.90
R5498:Cnot1 UTSW 8 96,483,983 (GRCm39) missense possibly damaging 0.92
R5719:Cnot1 UTSW 8 96,470,924 (GRCm39) missense possibly damaging 0.92
R5850:Cnot1 UTSW 8 96,460,775 (GRCm39) nonsense probably null
R5956:Cnot1 UTSW 8 96,481,606 (GRCm39) critical splice donor site probably null
R5981:Cnot1 UTSW 8 96,515,293 (GRCm39) missense probably damaging 1.00
R6093:Cnot1 UTSW 8 96,475,522 (GRCm39) missense probably benign 0.03
R6108:Cnot1 UTSW 8 96,457,048 (GRCm39) missense probably damaging 1.00
R6261:Cnot1 UTSW 8 96,468,549 (GRCm39) missense probably benign 0.00
R6632:Cnot1 UTSW 8 96,499,895 (GRCm39) intron probably benign
R6882:Cnot1 UTSW 8 96,447,054 (GRCm39) missense possibly damaging 0.85
R6966:Cnot1 UTSW 8 96,451,160 (GRCm39) missense probably damaging 1.00
R6985:Cnot1 UTSW 8 96,460,757 (GRCm39) missense probably benign 0.13
R7210:Cnot1 UTSW 8 96,515,286 (GRCm39) missense probably damaging 1.00
R7410:Cnot1 UTSW 8 96,459,787 (GRCm39) missense possibly damaging 0.77
R7623:Cnot1 UTSW 8 96,454,276 (GRCm39) missense probably damaging 1.00
R7624:Cnot1 UTSW 8 96,478,447 (GRCm39) missense probably damaging 1.00
R7695:Cnot1 UTSW 8 96,497,260 (GRCm39) missense probably benign 0.03
R7703:Cnot1 UTSW 8 96,486,726 (GRCm39) critical splice donor site probably null
R7771:Cnot1 UTSW 8 96,491,753 (GRCm39) missense probably damaging 0.99
R7800:Cnot1 UTSW 8 96,491,690 (GRCm39) missense probably benign 0.15
R7809:Cnot1 UTSW 8 96,478,406 (GRCm39) missense probably damaging 1.00
R7857:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
R7914:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
R7924:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
R7926:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
R7981:Cnot1 UTSW 8 96,489,797 (GRCm39) missense probably damaging 1.00
R8004:Cnot1 UTSW 8 96,479,380 (GRCm39) missense probably benign 0.03
R8061:Cnot1 UTSW 8 96,491,655 (GRCm39) missense possibly damaging 0.95
R8185:Cnot1 UTSW 8 96,487,979 (GRCm39) missense probably damaging 1.00
R8269:Cnot1 UTSW 8 96,478,389 (GRCm39) missense probably damaging 1.00
R8306:Cnot1 UTSW 8 96,473,649 (GRCm39) missense probably benign 0.05
R8322:Cnot1 UTSW 8 96,496,472 (GRCm39) missense probably benign 0.00
R8427:Cnot1 UTSW 8 96,460,952 (GRCm39) missense probably benign 0.01
R8723:Cnot1 UTSW 8 96,462,907 (GRCm39) missense probably benign 0.00
R8934:Cnot1 UTSW 8 96,491,695 (GRCm39) missense probably benign 0.04
R9025:Cnot1 UTSW 8 96,475,660 (GRCm39) missense probably benign
R9179:Cnot1 UTSW 8 96,500,054 (GRCm39) missense probably benign 0.16
R9280:Cnot1 UTSW 8 96,497,227 (GRCm39) missense probably benign 0.15
R9285:Cnot1 UTSW 8 96,452,746 (GRCm39) missense probably damaging 1.00
R9299:Cnot1 UTSW 8 96,468,448 (GRCm39) missense probably damaging 1.00
R9337:Cnot1 UTSW 8 96,468,448 (GRCm39) missense probably damaging 1.00
R9480:Cnot1 UTSW 8 96,497,338 (GRCm39) missense possibly damaging 0.94
R9548:Cnot1 UTSW 8 96,482,854 (GRCm39) missense probably benign 0.02
R9601:Cnot1 UTSW 8 96,482,835 (GRCm39) missense probably benign 0.02
R9629:Cnot1 UTSW 8 96,455,874 (GRCm39) missense probably damaging 0.98
R9752:Cnot1 UTSW 8 96,488,019 (GRCm39) missense probably damaging 1.00
R9764:Cnot1 UTSW 8 96,496,209 (GRCm39) missense probably benign 0.00
R9789:Cnot1 UTSW 8 96,455,772 (GRCm39) missense probably damaging 1.00
X0050:Cnot1 UTSW 8 96,469,726 (GRCm39) splice site probably null
Z1176:Cnot1 UTSW 8 96,474,905 (GRCm39) missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- AGCAAAGAGCATTGCCTACTCTCAC -3'
(R):5'- TCCCGTTCATCAGTCACTGTCTAAGTAA -3'

Sequencing Primer
(F):5'- AGCATTGCCTACTCTCACAGATG -3'
(R):5'- GCAAAGTGAATTATGGTGCATAC -3'
Posted On 2013-04-16