Mutagenetix > Incidental Mutation

Incidental Mutation 'R0335:Cnot1'

26196

Institutional Source

Beutler Lab

Gene Symbol

Cnot1

Ensembl Gene

ENSMUSG00000036550

Gene Name

CCR4-NOT transcription complex, subunit 1

Synonyms

6030411K04Rik

MMRRC Submission

038544-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0335 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

95719451-95807464 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 95772000 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 203 (I203K)

Ref Sequence

ENSEMBL: ENSMUSP00000148735 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000212323] [ENSMUST00000213006] [ENSMUST00000213046]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000068452
AA Change: I203K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: I203K

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
PDB:4J8S\|A	798	999	1e-137	PDB
low complexity region	1011	1028	N/A	INTRINSIC
low complexity region	1031	1055	N/A	INTRINSIC
PDB:4CT4\|C	1056	1295	1e-148	PDB
low complexity region	1296	1308	N/A	INTRINSIC
low complexity region	1328	1345	N/A	INTRINSIC
Pfam:DUF3819	1381	1530	2.5e-56	PFAM
low complexity region	1634	1648	N/A	INTRINSIC
Pfam:Not1	1991	2305	2.4e-125	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000098473
AA Change: I203K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: I203K

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
Pfam:CNOT1_HEAT	500	656	2.4e-57	PFAM
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
Pfam:CNOT1_TTP_bind	812	1004	1.4e-87	PFAM
low complexity region	1016	1033	N/A	INTRINSIC
low complexity region	1036	1060	N/A	INTRINSIC
Pfam:CNOT1_CAF1_bind	1087	1313	5.7e-99	PFAM
low complexity region	1333	1350	N/A	INTRINSIC
Pfam:DUF3819	1387	1534	2.3e-57	PFAM
low complexity region	1639	1653	N/A	INTRINSIC
Pfam:Not1	1998	2357	5.7e-157	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000211887
AA Change: I201K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212228

Predicted Effect

probably benign
Transcript: ENSMUST00000212323

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212863

Predicted Effect

probably benign
Transcript: ENSMUST00000213006
AA Change: I203K

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

Predicted Effect

probably benign
Transcript: ENSMUST00000213046

Meta Mutation Damage Score

0.2333

Coding Region Coverage

1x: 98.8%
3x: 97.6%
10x: 94.6%
20x: 87.5%

Validation Efficiency

100% (89/89)

MGI Phenotype

PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3830406C13Rik	A	G	14: 12,301,266	E124G	possibly damaging	Het
4932438A13Rik	T	C	3: 36,969,152	V2210A	probably damaging	Het
Adamts12	G	T	15: 11,311,058	D1134Y	possibly damaging	Het
Add3	A	G	19: 53,236,828	T460A	probably benign	Het
Amer3	A	C	1: 34,579,300		probably benign	Het
Arhgap22	C	T	14: 33,359,108		probably benign	Het
Arhgap32	T	G	9: 32,259,760	S1279A	probably benign	Het
Bcas1	G	A	2: 170,418,681	T26M	probably damaging	Het
Begain	A	T	12: 109,038,934	F256I	probably damaging	Het
Cabin1	A	T	10: 75,657,049	I1804N	probably damaging	Het
Cad	G	A	5: 31,073,985		probably benign	Het
Carmil1	G	A	13: 24,073,983	S762L	probably damaging	Het
Ccdc93	T	A	1: 121,492,977	L529Q	probably damaging	Het
Cdh12	T	A	15: 21,578,549		probably null	Het
Clip2	T	A	5: 134,535,215		probably benign	Het
Cmip	T	C	8: 117,445,366	I480T	probably damaging	Het
Col18a1	G	A	10: 77,059,363	P1155S	probably damaging	Het
Col1a2	T	A	6: 4,531,956		probably benign	Het
Crybg3	A	T	16: 59,544,140	L2373Q	probably damaging	Het
D130043K22Rik	A	T	13: 24,887,877	I935F	probably damaging	Het
Dapl1	T	A	2: 59,496,594	D61E	possibly damaging	Het
Def6	A	G	17: 28,228,069	D558G	possibly damaging	Het
Dnah6	T	C	6: 73,069,399		probably benign	Het
Dvl2	G	A	11: 70,001,035		probably benign	Het
Ecd	A	C	14: 20,320,734	V639G	probably benign	Het
Epg5	C	T	18: 77,986,472	T1350M	probably benign	Het
Erbb4	C	A	1: 68,259,259	M657I	probably benign	Het
Evi5	T	C	5: 107,812,411	R431G	probably benign	Het
Fbxo11	G	A	17: 88,015,613	A115V	possibly damaging	Het
Fgfr2	T	C	7: 130,196,249	T192A	probably benign	Het
Gas7	C	T	11: 67,662,052	A146V	possibly damaging	Het
Gatad2b	T	A	3: 90,356,182	S529T	probably benign	Het
Gm10722	G	T	9: 3,001,048	Q41H	probably null	Het
Gm10801	G	C	2: 98,664,007	R143T	possibly damaging	Het
Gm7535	A	G	17: 17,911,112		probably benign	Het
Gstm1	T	A	3: 108,012,696	N193I	possibly damaging	Het
Heatr5b	G	A	17: 78,827,946	P252L	probably benign	Het
Hmgb1	A	G	5: 149,050,631	V36A	probably benign	Het
Hrh1	G	T	6: 114,480,232	W158L	probably damaging	Het
Ighv6-4	T	C	12: 114,406,674	M53V	probably benign	Het
Iqgap2	T	A	13: 95,635,633	D1346V	probably damaging	Het
Kcng3	A	T	17: 83,587,737	N433K	possibly damaging	Het
Kif1a	T	A	1: 93,052,566		probably benign	Het
Lctl	C	A	9: 64,118,887	Q75K	probably benign	Het
Ldb3	T	A	14: 34,578,651	I89F	possibly damaging	Het
Lrrc49	A	T	9: 60,677,095	L156Q	probably damaging	Het
Mark2	G	T	19: 7,281,828	T83K	probably benign	Het
Ms4a15	A	T	19: 10,980,210	D170E	probably damaging	Het
Msantd2	A	G	9: 37,522,760	S99G	possibly damaging	Het
Nemf	G	T	12: 69,353,803	T124N	probably benign	Het
Nlrp9c	A	T	7: 26,394,136	F35I	possibly damaging	Het
Nwd2	A	G	5: 63,804,773	I567V	probably benign	Het
Olfr111	A	C	17: 37,530,642	I222L	probably benign	Het
Olfr1340	A	G	4: 118,727,170	I308V	probably null	Het
Olfr323	T	C	11: 58,625,740	Y102C	probably damaging	Het
Olfr828	T	A	9: 18,815,994	Q100L	probably damaging	Het
Optn	C	T	2: 5,024,115	G526R	probably damaging	Het
Pdk4	T	C	6: 5,491,138	E209G	probably benign	Het
Plch1	T	C	3: 63,710,978	Q712R	probably damaging	Het
Pnpla1	T	A	17: 28,886,878	V569E	possibly damaging	Het
Prkar2a	A	T	9: 108,719,258	D134V	probably damaging	Het
Ptov1	T	A	7: 44,864,622	Q40L	possibly damaging	Het
Ptprq	T	C	10: 107,708,728	I314V	probably benign	Het
Rabl2	T	C	15: 89,583,966	K66E	probably damaging	Het
Rnf38	A	G	4: 44,152,507	V19A	possibly damaging	Het
Scn2a	T	A	2: 65,682,091	W191R	probably damaging	Het
Sec22b	T	A	3: 97,921,256	F212I	possibly damaging	Het
Sec24c	T	A	14: 20,688,715		probably null	Het
Sept2	T	C	1: 93,495,599	S51P	probably damaging	Het
Serpinb1a	T	C	13: 32,848,656	N90S	probably damaging	Het
Slc1a2	C	T	2: 102,743,863	T206I	probably benign	Het
Slc25a19	C	A	11: 115,624,206	R42L	probably damaging	Het
St14	G	A	9: 31,091,324		probably benign	Het
Stxbp1	C	T	2: 32,802,905		probably benign	Het
Tas2r131	C	T	6: 132,957,829	V6I	probably benign	Het
Tdo2	T	A	3: 81,964,000	M235L	probably benign	Het
Tenm3	T	G	8: 48,232,105	H2432P	probably damaging	Het
Tmprss15	C	T	16: 79,024,742		probably benign	Het
Tmx1	A	G	12: 70,453,256	N30D	probably benign	Het
Tom1	A	G	8: 75,064,392		probably null	Het
Top2a	T	C	11: 99,022,955	N20S	probably benign	Het
Ttc23l	T	A	15: 10,539,963	T145S	probably benign	Het
Unc13b	T	A	4: 43,236,983	M3351K	possibly damaging	Het
Vmn1r47	T	C	6: 90,022,659	S258P	probably damaging	Het
Vmn2r8	T	G	5: 108,797,451		probably null	Het
Vps11	T	C	9: 44,353,838	Q641R	probably null	Het
Wapl	T	A	14: 34,692,324	I381N	probably damaging	Het
Zmym6	G	A	4: 127,122,808	G794E	probably damaging	Het

Other mutations in Cnot1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Cnot1	APN	8	95726079	missense	probably damaging	1.00
IGL01340:Cnot1	APN	8	95760537	missense	probably damaging	1.00
IGL01457:Cnot1	APN	8	95741009	missense	probably damaging	1.00
IGL01505:Cnot1	APN	8	95728718	missense	probably damaging	0.98
IGL02401:Cnot1	APN	8	95756133	missense	possibly damaging	0.95
IGL02693:Cnot1	APN	8	95773485	missense	probably damaging	1.00
IGL02696:Cnot1	APN	8	95745017	missense	probably benign	0.00
IGL02754:Cnot1	APN	8	95755078	missense	probably benign	0.03
IGL03092:Cnot1	APN	8	95769615	intron	probably benign
IGL03174:Cnot1	APN	8	95761355	missense	probably damaging	1.00
IGL03310:Cnot1	APN	8	95735680	splice site	probably benign
IGL03371:Cnot1	APN	8	95774716	missense	possibly damaging	0.85
Affiliate	UTSW	8	95765125	missense	probably damaging	0.99
Barge	UTSW	8	95734129	missense	probably benign	0.13
Byproduct	UTSW	8	95745647	frame shift	probably null
Chairman	UTSW	8	95765027	missense	possibly damaging	0.95
cohort	UTSW	8	95735749	missense	probably damaging	0.99
Director	UTSW	8	95765062	missense	probably benign	0.15
kowloon	UTSW	8	95788658	missense	probably damaging	1.00
Quorum	UTSW	8	95726118	missense	probably damaging	1.00
tugboat	UTSW	8	95773618	missense	probably damaging	0.99
Xiao	UTSW	8	95730420	missense	probably damaging	1.00
BB001:Cnot1	UTSW	8	95745647	frame shift	probably null
BB003:Cnot1	UTSW	8	95745647	frame shift	probably null
BB011:Cnot1	UTSW	8	95745647	frame shift	probably null
BB013:Cnot1	UTSW	8	95745647	frame shift	probably null
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0091:Cnot1	UTSW	8	95763144	missense	probably damaging	1.00
R0409:Cnot1	UTSW	8	95748855	missense	probably damaging	0.96
R0445:Cnot1	UTSW	8	95760208	missense	probably damaging	1.00
R1505:Cnot1	UTSW	8	95728667	missense	probably damaging	1.00
R1517:Cnot1	UTSW	8	95743213	missense	probably benign	0.38
R1640:Cnot1	UTSW	8	95769832	missense	probably damaging	0.98
R1737:Cnot1	UTSW	8	95748276	missense	probably damaging	0.98
R1755:Cnot1	UTSW	8	95724577	missense	probably damaging	1.00
R1901:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1902:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1903:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1988:Cnot1	UTSW	8	95741944	missense	possibly damaging	0.89
R2051:Cnot1	UTSW	8	95724593	missense	possibly damaging	0.47
R2054:Cnot1	UTSW	8	95739841	missense	possibly damaging	0.55
R2072:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2074:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2075:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2093:Cnot1	UTSW	8	95775358	missense	probably damaging	1.00
R2116:Cnot1	UTSW	8	95726153	missense	probably damaging	1.00
R2191:Cnot1	UTSW	8	95761426	missense	probably damaging	0.98
R2238:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2239:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2251:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2252:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2253:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2315:Cnot1	UTSW	8	95749062	missense	probably damaging	1.00
R2431:Cnot1	UTSW	8	95774652	missense	probably damaging	1.00
R2988:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R2989:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3108:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3109:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3114:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3115:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3153:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3154:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R4112:Cnot1	UTSW	8	95773618	missense	probably damaging	0.99
R4359:Cnot1	UTSW	8	95739848	missense	probably damaging	1.00
R4382:Cnot1	UTSW	8	95769779	missense	probably damaging	0.97
R4747:Cnot1	UTSW	8	95774682	missense	probably benign	0.27
R4910:Cnot1	UTSW	8	95733231	missense	probably benign	0.43
R4913:Cnot1	UTSW	8	95763067	missense	possibly damaging	0.63
R4971:Cnot1	UTSW	8	95721626	missense	probably damaging	1.00
R5056:Cnot1	UTSW	8	95741008	missense	probably damaging	1.00
R5092:Cnot1	UTSW	8	95752768	missense	possibly damaging	0.91
R5101:Cnot1	UTSW	8	95760187	missense	possibly damaging	0.90
R5498:Cnot1	UTSW	8	95757355	missense	possibly damaging	0.92
R5719:Cnot1	UTSW	8	95744296	missense	possibly damaging	0.92
R5850:Cnot1	UTSW	8	95734147	nonsense	probably null
R5956:Cnot1	UTSW	8	95754978	critical splice donor site	probably null
R5981:Cnot1	UTSW	8	95788665	missense	probably damaging	1.00
R6093:Cnot1	UTSW	8	95748894	missense	probably benign	0.03
R6108:Cnot1	UTSW	8	95730420	missense	probably damaging	1.00
R6261:Cnot1	UTSW	8	95741921	missense	probably benign	0.00
R6632:Cnot1	UTSW	8	95773267	intron	probably benign
R6882:Cnot1	UTSW	8	95720426	missense	possibly damaging	0.85
R6966:Cnot1	UTSW	8	95724532	missense	probably damaging	1.00
R6985:Cnot1	UTSW	8	95734129	missense	probably benign	0.13
R7210:Cnot1	UTSW	8	95788658	missense	probably damaging	1.00
R7410:Cnot1	UTSW	8	95733159	missense	possibly damaging	0.77
R7623:Cnot1	UTSW	8	95727648	missense	probably damaging	1.00
R7624:Cnot1	UTSW	8	95751819	missense	probably damaging	1.00
R7695:Cnot1	UTSW	8	95770632	missense	probably benign	0.03
R7703:Cnot1	UTSW	8	95760098	critical splice donor site	probably null
R7771:Cnot1	UTSW	8	95765125	missense	probably damaging	0.99
R7800:Cnot1	UTSW	8	95765062	missense	probably benign	0.15
R7809:Cnot1	UTSW	8	95751778	missense	probably damaging	1.00
R7857:Cnot1	UTSW	8	95745647	frame shift	probably null
R7914:Cnot1	UTSW	8	95745647	frame shift	probably null
R7924:Cnot1	UTSW	8	95745647	frame shift	probably null
R7926:Cnot1	UTSW	8	95745647	frame shift	probably null
R7981:Cnot1	UTSW	8	95763169	missense	probably damaging	1.00
R8004:Cnot1	UTSW	8	95752752	missense	probably benign	0.03
R8061:Cnot1	UTSW	8	95765027	missense	possibly damaging	0.95
R8185:Cnot1	UTSW	8	95761351	missense	probably damaging	1.00
R8269:Cnot1	UTSW	8	95751761	missense	probably damaging	1.00
R8306:Cnot1	UTSW	8	95747021	missense	probably benign	0.05
R8322:Cnot1	UTSW	8	95769844	missense	probably benign	0.00
R8427:Cnot1	UTSW	8	95734324	missense	probably benign	0.01
R8723:Cnot1	UTSW	8	95736279	missense	probably benign	0.00
R8934:Cnot1	UTSW	8	95765067	missense	probably benign	0.04
R9025:Cnot1	UTSW	8	95749032	missense	probably benign
R9179:Cnot1	UTSW	8	95773426	missense	probably benign	0.16
R9280:Cnot1	UTSW	8	95770599	missense	probably benign	0.15
R9285:Cnot1	UTSW	8	95726118	missense	probably damaging	1.00
R9299:Cnot1	UTSW	8	95741820	missense	probably damaging	1.00
R9337:Cnot1	UTSW	8	95741820	missense	probably damaging	1.00
R9480:Cnot1	UTSW	8	95770710	missense	possibly damaging	0.94
R9548:Cnot1	UTSW	8	95756226	missense	probably benign	0.02
R9601:Cnot1	UTSW	8	95756207	missense	probably benign	0.02
R9629:Cnot1	UTSW	8	95729246	missense	probably damaging	0.98
R9752:Cnot1	UTSW	8	95761391	missense	probably damaging	1.00
R9764:Cnot1	UTSW	8	95769581	missense	probably benign	0.00
R9789:Cnot1	UTSW	8	95729144	missense	probably damaging	1.00
X0050:Cnot1	UTSW	8	95743098	splice site	probably null
Z1176:Cnot1	UTSW	8	95748277	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- AGCAAAGAGCATTGCCTACTCTCAC -3'
(R):5'- TCCCGTTCATCAGTCACTGTCTAAGTAA -3'

Sequencing Primer
(F):5'- AGCATTGCCTACTCTCACAGATG -3'
(R):5'- GCAAAGTGAATTATGGTGCATAC -3'

Posted On

2013-04-16