Incidental Mutation 'R0670:Treml2'
ID261988
Institutional Source Beutler Lab
Gene Symbol Treml2
Ensembl Gene ENSMUSG00000071068
Gene Nametriggering receptor expressed on myeloid cells-like 2
SynonymsLOC328833
MMRRC Submission 038855-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R0670 (G1)
Quality Score93
Status Not validated
Chromosome17
Chromosomal Location48300038-48312534 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 48307836 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170941]
Predicted Effect probably null
Transcript: ENSMUST00000170941
SMART Domains Protein: ENSMUSP00000128215
Gene: ENSMUSG00000071068

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 129 3.13e-5 SMART
low complexity region 181 199 N/A INTRINSIC
transmembrane domain 268 290 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TREML2 is located in a gene cluster on chromosome 6 with the single Ig variable (IgV) domain activating receptors TREM1 (MIM 605085) and TREM2 (MIM 605086), but it has distinct structural and functional properties (Allcock et al., 2003 [PubMed 12645956]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
a A T 2: 155,045,758 D46V probably damaging Het
Abraxas2 A T 7: 132,869,031 probably null Het
Afap1l2 G A 19: 56,915,803 T684I probably damaging Het
Ahcyl1 A T 3: 107,671,165 V205E probably damaging Het
Ap4e1 T A 2: 127,011,864 probably null Het
Brms1 C A 19: 5,045,971 N24K probably damaging Het
Celf3 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA 3: 94,488,230 probably benign Het
Col25a1 A G 3: 130,386,895 K130E possibly damaging Het
Crisp1 A C 17: 40,305,110 Y125* probably null Het
Dnhd1 A T 7: 105,696,464 D2272V possibly damaging Het
Elmod1 A G 9: 53,912,822 V294A probably damaging Het
Gm8909 G C 17: 36,168,098 F86L possibly damaging Het
Gmfg T A 7: 28,441,528 I33K probably damaging Het
Gsk3b G T 16: 38,144,316 D49Y probably damaging Het
Harbi1 C T 2: 91,712,535 R114W probably damaging Het
Hspbp1 A G 7: 4,677,736 V247A probably damaging Het
Kif17 A T 4: 138,262,499 probably benign Het
Klhl6 T A 16: 19,949,559 H412L possibly damaging Het
Muc1 A G 3: 89,230,532 D227G probably benign Het
Nat8f5 A T 6: 85,817,975 M1K probably null Het
Neb A G 2: 52,256,124 V2947A possibly damaging Het
Nfrkb A T 9: 31,420,173 Q1295L probably benign Het
Otop1 T C 5: 38,287,948 V150A possibly damaging Het
Pcdhb2 A T 18: 37,296,648 D558V probably damaging Het
Pdilt T C 7: 119,500,428 K206E probably benign Het
Pkn2 A T 3: 142,839,343 I23K probably damaging Het
Plec A T 15: 76,205,960 L60Q probably damaging Het
Ranbp2 C A 10: 58,480,698 D2413E probably benign Het
Socs1 A G 16: 10,784,262 Y204H probably damaging Het
Stk39 T C 2: 68,366,182 D301G possibly damaging Het
Tlr5 T A 1: 182,973,889 W253R probably damaging Het
Ttn A G 2: 76,749,104 L22069P probably damaging Het
Vps13c G T 9: 67,925,857 S1614I probably benign Het
Vrk2 C T 11: 26,486,959 probably null Het
Xrn1 A G 9: 95,991,056 Y655C probably damaging Het
Other mutations in Treml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01767:Treml2 APN 17 48302810 missense probably benign
IGL02797:Treml2 APN 17 48302711 missense possibly damaging 0.73
R0105:Treml2 UTSW 17 48302828 missense probably damaging 0.99
R0105:Treml2 UTSW 17 48302828 missense probably damaging 0.99
R1538:Treml2 UTSW 17 48302758 missense possibly damaging 0.77
R1796:Treml2 UTSW 17 48309502 makesense probably null
R4396:Treml2 UTSW 17 48308114 missense probably benign 0.00
R4679:Treml2 UTSW 17 48308175 missense probably benign 0.36
R4687:Treml2 UTSW 17 48309397 splice site probably null
R4801:Treml2 UTSW 17 48309159 missense probably benign 0.18
R4802:Treml2 UTSW 17 48309159 missense probably benign 0.18
R5314:Treml2 UTSW 17 48300573 missense probably damaging 0.99
R6791:Treml2 UTSW 17 48309219 missense probably benign 0.24
R6818:Treml2 UTSW 17 48302897 missense probably damaging 1.00
R6958:Treml2 UTSW 17 48308152 missense probably damaging 1.00
R7250:Treml2 UTSW 17 48309127 missense probably benign 0.05
R7535:Treml2 UTSW 17 48302819 missense probably damaging 1.00
Predicted Primers
Posted On2015-02-04