Incidental Mutation 'R0724:Gata3'
ID 262000
Institutional Source Beutler Lab
Gene Symbol Gata3
Ensembl Gene ENSMUSG00000015619
Gene Name GATA binding protein 3
Synonyms Gata-3, jal
MMRRC Submission 038906-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0724 (G1)
Quality Score 65
Status Validated
Chromosome 2
Chromosomal Location 9857078-9890034 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 9874575 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 197 (T197A)
Ref Sequence ENSEMBL: ENSMUSP00000100041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102976] [ENSMUST00000130615]
AlphaFold P23772
PDB Structure Adjacent GATA DNA binding [X-RAY DIFFRACTION]
Opposite GATA DNA binding [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000102976
AA Change: T197A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100041
Gene: ENSMUSG00000015619
AA Change: T197A

DomainStartEndE-ValueType
low complexity region 128 149 N/A INTRINSIC
low complexity region 153 165 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
ZnF_GATA 257 307 3.65e-20 SMART
ZnF_GATA 311 361 2.9e-23 SMART
low complexity region 367 377 N/A INTRINSIC
low complexity region 399 425 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130615
SMART Domains Protein: ENSMUSP00000119730
Gene: ENSMUSG00000015619

DomainStartEndE-ValueType
low complexity region 93 114 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142305
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147533
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151456
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153509
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the GATA family of transcription factors. The protein contains two GATA-type zinc fingers and is an important regulator of T-cell development and plays an important role in endothelial cell biology. Defects in this gene are the cause of hypoparathyroidism with sensorineural deafness and renal dysplasia. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous inactivation is embryonic lethal and show a variety of embryonic defects. T cell development is impaired when the locus is conditionally. Mice with a spontaneous mutation exhibit partial hair loss and various defects in hair structure and in hair growth cycle regulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 145,044,763 E136G probably benign Het
Adgre4 T A 17: 55,852,281 S655R probably benign Het
Ak7 T A 12: 105,710,254 V71E probably benign Het
Ank2 C T 3: 126,962,337 R1077H probably damaging Het
Anxa3 A G 5: 96,828,748 T198A possibly damaging Het
Atp1a1 A T 3: 101,592,439 I109N possibly damaging Het
Camta1 A G 4: 151,077,892 I119T probably damaging Het
Carm1 A G 9: 21,587,374 Y504C probably damaging Het
Casp1 C T 9: 5,303,077 P177L probably benign Het
Ccdc122 C A 14: 77,092,077 probably benign Het
Ces1a A G 8: 93,039,513 S158P probably damaging Het
Ces3a T A 8: 105,050,195 D103E possibly damaging Het
Clstn1 A C 4: 149,643,624 D583A possibly damaging Het
Corin A G 5: 72,332,795 probably benign Het
Cryba1 T C 11: 77,719,457 D144G probably damaging Het
Cwf19l2 G T 9: 3,421,377 probably null Het
Dis3l T C 9: 64,307,126 T1027A possibly damaging Het
Dopey2 A G 16: 93,762,325 E653G probably benign Het
Dst A G 1: 34,188,677 I1459V probably benign Het
Dyrk3 T C 1: 131,130,140 T64A probably benign Het
Emp2 C T 16: 10,284,615 C111Y probably benign Het
Enam A G 5: 88,501,994 Y454C probably damaging Het
Fbn1 A T 2: 125,352,064 C1328S probably benign Het
Gm1043 A G 5: 37,187,229 T212A probably damaging Het
Gm15448 T C 7: 3,816,872 N564S possibly damaging Het
H2-Eb1 T C 17: 34,315,032 probably benign Het
Hand1 T C 11: 57,831,680 H36R probably damaging Het
Hmgcs2 C A 3: 98,297,001 Y239* probably null Het
Hoxc12 A G 15: 102,937,055 Y68C probably damaging Het
Inpp5a A G 7: 139,516,663 I143V probably benign Het
Klhdc2 C A 12: 69,297,048 F18L probably benign Het
Kpnb1 T C 11: 97,178,304 Y251C probably damaging Het
Lrch4 A T 5: 137,637,308 N315I probably damaging Het
Map3k10 A C 7: 27,668,355 V286G probably damaging Het
Myo7b G A 18: 32,005,549 probably benign Het
Nlrp2 G T 7: 5,319,222 L809I probably damaging Het
Oacyl T C 18: 65,737,825 probably benign Het
Olfr735 A G 14: 50,345,917 V175A possibly damaging Het
Paxbp1 T A 16: 91,036,536 D270V probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Plcb3 G A 19: 6,963,392 R359C probably damaging Het
Plcxd3 G A 15: 4,516,868 S118N probably damaging Het
Ptpn14 T C 1: 189,850,947 S664P possibly damaging Het
Sirt1 T C 10: 63,323,973 I443V possibly damaging Het
Slc7a8 G A 14: 54,735,186 probably benign Het
Smim14 A G 5: 65,453,339 probably benign Het
Sost C T 11: 101,966,918 C19Y probably benign Het
Tcaf1 G T 6: 42,675,367 A727E probably damaging Het
Thoc1 T C 18: 9,963,829 L144P probably damaging Het
Tmem132b A T 5: 125,783,421 T577S possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tshr T C 12: 91,538,286 F666S probably damaging Het
Wdr1 A G 5: 38,540,862 V192A possibly damaging Het
Zfp697 T C 3: 98,428,166 W416R probably damaging Het
Other mutations in Gata3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:Gata3 APN 2 9877465 missense probably damaging 1.00
IGL03168:Gata3 APN 2 9868814 missense probably damaging 1.00
R0054:Gata3 UTSW 2 9858447 missense probably damaging 1.00
R0123:Gata3 UTSW 2 9874809 missense probably benign 0.11
R0225:Gata3 UTSW 2 9874809 missense probably benign 0.11
R1491:Gata3 UTSW 2 9877390 missense probably damaging 0.96
R1576:Gata3 UTSW 2 9863196 missense probably damaging 0.98
R1608:Gata3 UTSW 2 9874768 nonsense probably null
R1667:Gata3 UTSW 2 9877549 missense possibly damaging 0.95
R3119:Gata3 UTSW 2 9877585 critical splice acceptor site probably null
R3753:Gata3 UTSW 2 9868840 missense probably benign 0.39
R3876:Gata3 UTSW 2 9863143 missense probably damaging 1.00
R5040:Gata3 UTSW 2 9858515 missense probably damaging 1.00
R5292:Gata3 UTSW 2 9868874 missense probably damaging 1.00
R6414:Gata3 UTSW 2 9858434 missense possibly damaging 0.95
R6696:Gata3 UTSW 2 9874492 nonsense probably null
R6848:Gata3 UTSW 2 9858528 missense possibly damaging 0.88
R7580:Gata3 UTSW 2 9863132 missense probably damaging 1.00
R7900:Gata3 UTSW 2 9858650 missense probably damaging 1.00
R8551:Gata3 UTSW 2 9863183 missense probably damaging 1.00
R9602:Gata3 UTSW 2 9858486 missense possibly damaging 0.86
R9775:Gata3 UTSW 2 9858386 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGGCCTCGACTTACATCCGAAC -3'
(R):5'- GCATCACAGGGAGCCAGGTATG -3'

Sequencing Primer
(F):5'- TTACATCCGAACCCGGTAGG -3'
(R):5'- TGCTGCACGGATCTCTGC -3'
Posted On 2015-02-04