Mutagenetix > Incidental Mutation

Incidental Mutation 'R0724:Clstn1'

262004

Institutional Source

Beutler Lab

Gene Symbol

Clstn1

Ensembl Gene

ENSMUSG00000039953

Gene Name

calsyntenin 1

Synonyms

Cst-1, calsyntenin-1, 1810034E21Rik, alcadein alpha

MMRRC Submission

038906-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0724 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

149586468-149648899 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 149643624 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 583 (D583A)

Ref Sequence

ENSEMBL: ENSMUSP00000101316 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039144] [ENSMUST00000105691]

AlphaFold

Q9EPL2

Predicted Effect

probably benign
Transcript: ENSMUST00000039144
AA Change: D593A

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000036962
Gene: ENSMUSG00000039953
AA Change: D593A

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
CA	59	162	1.25e-11	SMART
CA	185	263	1.03e-3	SMART
Pfam:Laminin_G_3	365	510	3.3e-9	PFAM
low complexity region	663	674	N/A	INTRINSIC
transmembrane domain	860	882	N/A	INTRINSIC
coiled coil region	915	949	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105691
AA Change: D583A

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000101316
Gene: ENSMUSG00000039953
AA Change: D583A

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
CA	59	152	2.91e-12	SMART
CA	175	253	1.03e-3	SMART
Pfam:Laminin_G_3	350	544	1.1e-12	PFAM
low complexity region	653	664	N/A	INTRINSIC
transmembrane domain	850	872	N/A	INTRINSIC
coiled coil region	905	939	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.9%
10x: 97.5%
20x: 95.2%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the calsyntenin family, a subset of the cadherin superfamily. The encoded transmembrane protein, also known as alcadein-alpha, is thought to bind to kinesin-1 motors to mediate the axonal anterograde transport of certain types of vesicle. Amyloid precursor protein (APP) is trafficked via these vesicles and so this protein is being investigated to see how it might contribute to the mechanisms underlying Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Juvenile mice homozygous for a null allele show reduced basal excitatory synaptic transmission, abnormal excitatory postsynaptic currents, enhanced NMDA receptor-dependent long term potentiation, and delayed dendritic spine maturation in CA1 hippocampal pyramidal cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700018F24Rik	A	G	5: 145,044,763	E136G	probably benign	Het
Adgre4	T	A	17: 55,852,281	S655R	probably benign	Het
Ak7	T	A	12: 105,710,254	V71E	probably benign	Het
Ank2	C	T	3: 126,962,337	R1077H	probably damaging	Het
Anxa3	A	G	5: 96,828,748	T198A	possibly damaging	Het
Atp1a1	A	T	3: 101,592,439	I109N	possibly damaging	Het
Camta1	A	G	4: 151,077,892	I119T	probably damaging	Het
Carm1	A	G	9: 21,587,374	Y504C	probably damaging	Het
Casp1	C	T	9: 5,303,077	P177L	probably benign	Het
Ccdc122	C	A	14: 77,092,077		probably benign	Het
Ces1a	A	G	8: 93,039,513	S158P	probably damaging	Het
Ces3a	T	A	8: 105,050,195	D103E	possibly damaging	Het
Corin	A	G	5: 72,332,795		probably benign	Het
Cryba1	T	C	11: 77,719,457	D144G	probably damaging	Het
Cwf19l2	G	T	9: 3,421,377		probably null	Het
Dis3l	T	C	9: 64,307,126	T1027A	possibly damaging	Het
Dopey2	A	G	16: 93,762,325	E653G	probably benign	Het
Dst	A	G	1: 34,188,677	I1459V	probably benign	Het
Dyrk3	T	C	1: 131,130,140	T64A	probably benign	Het
Emp2	C	T	16: 10,284,615	C111Y	probably benign	Het
Enam	A	G	5: 88,501,994	Y454C	probably damaging	Het
Fbn1	A	T	2: 125,352,064	C1328S	probably benign	Het
Gata3	T	C	2: 9,874,575	T197A	probably benign	Het
Gm1043	A	G	5: 37,187,229	T212A	probably damaging	Het
Gm15448	T	C	7: 3,816,872	N564S	possibly damaging	Het
H2-Eb1	T	C	17: 34,315,032		probably benign	Het
Hand1	T	C	11: 57,831,680	H36R	probably damaging	Het
Hmgcs2	C	A	3: 98,297,001	Y239*	probably null	Het
Hoxc12	A	G	15: 102,937,055	Y68C	probably damaging	Het
Inpp5a	A	G	7: 139,516,663	I143V	probably benign	Het
Klhdc2	C	A	12: 69,297,048	F18L	probably benign	Het
Kpnb1	T	C	11: 97,178,304	Y251C	probably damaging	Het
Lrch4	A	T	5: 137,637,308	N315I	probably damaging	Het
Map3k10	A	C	7: 27,668,355	V286G	probably damaging	Het
Myo7b	G	A	18: 32,005,549		probably benign	Het
Nlrp2	G	T	7: 5,319,222	L809I	probably damaging	Het
Oacyl	T	C	18: 65,737,825		probably benign	Het
Olfr735	A	G	14: 50,345,917	V175A	possibly damaging	Het
Paxbp1	T	A	16: 91,036,536	D270V	probably damaging	Het
Pdia3	G	A	2: 121,432,377	G275S	probably damaging	Het
Plcb3	G	A	19: 6,963,392	R359C	probably damaging	Het
Plcxd3	G	A	15: 4,516,868	S118N	probably damaging	Het
Ptpn14	T	C	1: 189,850,947	S664P	possibly damaging	Het
Sirt1	T	C	10: 63,323,973	I443V	possibly damaging	Het
Slc7a8	G	A	14: 54,735,186		probably benign	Het
Smim14	A	G	5: 65,453,339		probably benign	Het
Sost	C	T	11: 101,966,918	C19Y	probably benign	Het
Tcaf1	G	T	6: 42,675,367	A727E	probably damaging	Het
Thoc1	T	C	18: 9,963,829	L144P	probably damaging	Het
Tmem132b	A	T	5: 125,783,421	T577S	possibly damaging	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Tshr	T	C	12: 91,538,286	F666S	probably damaging	Het
Wdr1	A	G	5: 38,540,862	V192A	possibly damaging	Het
Zfp697	T	C	3: 98,428,166	W416R	probably damaging	Het

Other mutations in Clstn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00486:Clstn1	APN	4	149635243	missense	probably damaging	0.99
IGL00585:Clstn1	APN	4	149638312	missense	probably benign	0.05
IGL00911:Clstn1	APN	4	149643191	splice site	probably benign
IGL01394:Clstn1	APN	4	149634782	missense	possibly damaging	0.87
IGL02193:Clstn1	APN	4	149645352	missense	probably benign	0.03
IGL02406:Clstn1	APN	4	149627359	missense	probably damaging	1.00
IGL02501:Clstn1	APN	4	149631842	missense	probably damaging	1.00
IGL02641:Clstn1	APN	4	149629511	missense	probably null	1.00
R0012:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0020:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0021:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0026:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0031:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0038:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0062:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0064:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0193:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0279:Clstn1	UTSW	4	149643674	missense	probably damaging	1.00
R0394:Clstn1	UTSW	4	149644178	missense	probably benign	0.00
R0609:Clstn1	UTSW	4	149629300	splice site	probably null
R0685:Clstn1	UTSW	4	149646855	missense	probably benign	0.24
R1016:Clstn1	UTSW	4	149646829	missense	probably benign	0.21
R1470:Clstn1	UTSW	4	149634722	missense	possibly damaging	0.94
R1470:Clstn1	UTSW	4	149634722	missense	possibly damaging	0.94
R1622:Clstn1	UTSW	4	149629407	missense	probably damaging	0.97
R1680:Clstn1	UTSW	4	149643726	missense	probably benign	0.02
R3803:Clstn1	UTSW	4	149635339	missense	probably damaging	0.99
R3836:Clstn1	UTSW	4	149638333	missense	probably damaging	1.00
R3838:Clstn1	UTSW	4	149638333	missense	probably damaging	1.00
R4923:Clstn1	UTSW	4	149645029	missense	probably benign	0.07
R5024:Clstn1	UTSW	4	149635294	missense	possibly damaging	0.91
R5919:Clstn1	UTSW	4	149635246	missense	probably damaging	1.00
R6269:Clstn1	UTSW	4	149644067	missense	probably benign	0.00
R6354:Clstn1	UTSW	4	149643216	missense	probably benign	0.05
R6382:Clstn1	UTSW	4	149626120	splice site	probably null
R6573:Clstn1	UTSW	4	149643689	missense	probably damaging	1.00
R7342:Clstn1	UTSW	4	149629430	missense	probably damaging	0.98
R7457:Clstn1	UTSW	4	149634916	missense	probably benign	0.03
R7571:Clstn1	UTSW	4	149646287	missense	probably benign	0.38
R7682:Clstn1	UTSW	4	149626101	missense	possibly damaging	0.72
R7738:Clstn1	UTSW	4	149635354	missense	probably damaging	1.00
R7803:Clstn1	UTSW	4	149631871	missense	probably damaging	1.00
R7904:Clstn1	UTSW	4	149614137	missense	probably benign	0.01
R7918:Clstn1	UTSW	4	149644051	missense	probably damaging	0.98
R8007:Clstn1	UTSW	4	149631848	missense	probably damaging	1.00
R8821:Clstn1	UTSW	4	149646323	missense	probably benign	0.00
R8831:Clstn1	UTSW	4	149646323	missense	probably benign	0.00
R9169:Clstn1	UTSW	4	149646865	missense	possibly damaging	0.68
R9173:Clstn1	UTSW	4	149626107	missense	probably benign	0.08
R9463:Clstn1	UTSW	4	149614107	missense	possibly damaging	0.92
R9491:Clstn1	UTSW	4	149647472	missense	probably damaging	1.00
R9615:Clstn1	UTSW	4	149638300	missense	probably damaging	1.00
X0020:Clstn1	UTSW	4	149635251	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGTCCCTGAAGATGCCAACAGAG -3'
(R):5'- AGATCAAGTGATGACCCACCTTCCC -3'

Sequencing Primer
(F):5'- GGACTTTACCCTATGTGAGCATC -3'
(R):5'- AACAGGCTAAAGACCTAAAGGC -3'

Posted On

2015-02-04