Incidental Mutation 'R0724:Wdr1'
ID262006
Institutional Source Beutler Lab
Gene Symbol Wdr1
Ensembl Gene ENSMUSG00000005103
Gene NameWD repeat domain 1
SynonymsAip1, rede, D5Wsu185e
MMRRC Submission 038906-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0724 (G1)
Quality Score71
Status Validated
Chromosome5
Chromosomal Location38526813-38563221 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38540862 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 192 (V192A)
Ref Sequence ENSEMBL: ENSMUSP00000005234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005234] [ENSMUST00000201260]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005234
AA Change: V192A

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000005234
Gene: ENSMUSG00000005103
AA Change: V192A

DomainStartEndE-ValueType
WD40 47 86 1.7e-2 SMART
WD40 91 134 5.52e0 SMART
WD40 135 175 3.69e-3 SMART
WD40 178 217 4.4e-10 SMART
WD40 220 262 1.74e-8 SMART
WD40 309 350 7.05e-9 SMART
WD40 354 392 6.9e-1 SMART
WD40 434 473 1.36e-1 SMART
WD40 478 517 7.8e-2 SMART
WD40 521 560 1.83e-7 SMART
WD40 564 603 3.71e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201150
Predicted Effect probably benign
Transcript: ENSMUST00000201260
SMART Domains Protein: ENSMUSP00000143937
Gene: ENSMUSG00000005103

DomainStartEndE-ValueType
WD40 36 77 4.6e-11 SMART
WD40 81 119 4.5e-3 SMART
WD40 161 200 8.9e-4 SMART
WD40 205 244 4.9e-4 SMART
WD40 248 287 1.2e-9 SMART
WD40 291 330 2.4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202766
Meta Mutation Damage Score 0.8316 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing 9 WD repeats. WD repeats are approximately 30- to 40-amino acid domains containing several conserved residues, mostly including a trp-asp at the C-terminal end. WD domains are involved in protein-protein interactions. The encoded protein may help induce the disassembly of actin filaments. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Severe loss of function at this locus causes embryonic lethality. Mice homozygous for a hypomorphic ENU-induced allele exhibit thrombocytopenia due to impaired megakaryocyte maturation and platelet shedding, and develop autoinflammatory disease associated with defects in neutrophil function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 145,044,763 E136G probably benign Het
Adgre4 T A 17: 55,852,281 S655R probably benign Het
Ak7 T A 12: 105,710,254 V71E probably benign Het
Ank2 C T 3: 126,962,337 R1077H probably damaging Het
Anxa3 A G 5: 96,828,748 T198A possibly damaging Het
Atp1a1 A T 3: 101,592,439 I109N possibly damaging Het
Camta1 A G 4: 151,077,892 I119T probably damaging Het
Carm1 A G 9: 21,587,374 Y504C probably damaging Het
Casp1 C T 9: 5,303,077 P177L probably benign Het
Ccdc122 C A 14: 77,092,077 probably benign Het
Ces1a A G 8: 93,039,513 S158P probably damaging Het
Ces3a T A 8: 105,050,195 D103E possibly damaging Het
Clstn1 A C 4: 149,643,624 D583A possibly damaging Het
Corin A G 5: 72,332,795 probably benign Het
Cryba1 T C 11: 77,719,457 D144G probably damaging Het
Cwf19l2 G T 9: 3,421,377 probably null Het
Dis3l T C 9: 64,307,126 T1027A possibly damaging Het
Dopey2 A G 16: 93,762,325 E653G probably benign Het
Dst A G 1: 34,188,677 I1459V probably benign Het
Dyrk3 T C 1: 131,130,140 T64A probably benign Het
Emp2 C T 16: 10,284,615 C111Y probably benign Het
Enam A G 5: 88,501,994 Y454C probably damaging Het
Fbn1 A T 2: 125,352,064 C1328S probably benign Het
Gata3 T C 2: 9,874,575 T197A probably benign Het
Gm1043 A G 5: 37,187,229 T212A probably damaging Het
Gm15448 T C 7: 3,816,872 N564S possibly damaging Het
H2-Eb1 T C 17: 34,315,032 probably benign Het
Hand1 T C 11: 57,831,680 H36R probably damaging Het
Hmgcs2 C A 3: 98,297,001 Y239* probably null Het
Hoxc12 A G 15: 102,937,055 Y68C probably damaging Het
Inpp5a A G 7: 139,516,663 I143V probably benign Het
Klhdc2 C A 12: 69,297,048 F18L probably benign Het
Kpnb1 T C 11: 97,178,304 Y251C probably damaging Het
Lrch4 A T 5: 137,637,308 N315I probably damaging Het
Map3k10 A C 7: 27,668,355 V286G probably damaging Het
Myo7b G A 18: 32,005,549 probably benign Het
Nlrp2 G T 7: 5,319,222 L809I probably damaging Het
Oacyl T C 18: 65,737,825 probably benign Het
Olfr735 A G 14: 50,345,917 V175A possibly damaging Het
Paxbp1 T A 16: 91,036,536 D270V probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Plcb3 G A 19: 6,963,392 R359C probably damaging Het
Plcxd3 G A 15: 4,516,868 S118N probably damaging Het
Ptpn14 T C 1: 189,850,947 S664P possibly damaging Het
Sirt1 T C 10: 63,323,973 I443V possibly damaging Het
Slc7a8 G A 14: 54,735,186 probably benign Het
Smim14 A G 5: 65,453,339 probably benign Het
Sost C T 11: 101,966,918 C19Y probably benign Het
Tcaf1 G T 6: 42,675,367 A727E probably damaging Het
Thoc1 T C 18: 9,963,829 L144P probably damaging Het
Tmem132b A T 5: 125,783,421 T577S possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tshr T C 12: 91,538,286 F666S probably damaging Het
Zfp697 T C 3: 98,428,166 W416R probably damaging Het
Other mutations in Wdr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00939:Wdr1 APN 5 38535323 missense probably benign 0.00
IGL01071:Wdr1 APN 5 38530067 missense probably benign 0.14
IGL01293:Wdr1 APN 5 38529543 missense probably benign 0.00
IGL01347:Wdr1 APN 5 38545715 missense possibly damaging 0.77
IGL01532:Wdr1 APN 5 38535187 missense probably damaging 1.00
IGL02409:Wdr1 APN 5 38531110 missense probably benign 0.06
IGL02415:Wdr1 APN 5 38531110 missense probably damaging 1.00
IGL02543:Wdr1 APN 5 38545822 missense probably damaging 1.00
IGL02550:Wdr1 APN 5 38540863 missense probably damaging 1.00
IGL03093:Wdr1 APN 5 38561129 missense probably benign 0.01
IGL03183:Wdr1 APN 5 38533482 critical splice donor site probably null
R1509:Wdr1 UTSW 5 38540562 missense probably damaging 0.96
R1589:Wdr1 UTSW 5 38529972 missense probably benign 0.43
R3039:Wdr1 UTSW 5 38530085 missense possibly damaging 0.94
R3767:Wdr1 UTSW 5 38540539 missense probably damaging 1.00
R4833:Wdr1 UTSW 5 38547029 missense probably damaging 1.00
R5405:Wdr1 UTSW 5 38535200 missense probably benign 0.03
R5475:Wdr1 UTSW 5 38529588 missense probably damaging 1.00
R5476:Wdr1 UTSW 5 38529588 missense probably damaging 1.00
R5619:Wdr1 UTSW 5 38529536 missense possibly damaging 0.93
R5852:Wdr1 UTSW 5 38537175 missense probably benign 0.00
R5876:Wdr1 UTSW 5 38530023 missense probably benign 0.01
R6170:Wdr1 UTSW 5 38529671 critical splice acceptor site probably null
R6367:Wdr1 UTSW 5 38545846 missense possibly damaging 0.68
R6524:Wdr1 UTSW 5 38530063 missense probably benign 0.07
R6643:Wdr1 UTSW 5 38540178 missense probably damaging 1.00
R6838:Wdr1 UTSW 5 38530031 missense probably damaging 0.96
R7305:Wdr1 UTSW 5 38540092 missense possibly damaging 0.90
R8364:Wdr1 UTSW 5 38527849 missense possibly damaging 0.80
R8380:Wdr1 UTSW 5 38540521 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ACCATTTCCCCAGTGATTGTGGC -3'
(R):5'- AGTGACCAGGCAGGAACAGACTTC -3'

Sequencing Primer
(F):5'- GTACAGTTGGAACCTTGAACATTC -3'
(R):5'- AAATGCCATGATGGGCTCTC -3'
Posted On2015-02-04