Incidental Mutation 'R0724:Anxa3'
ID262008
Institutional Source Beutler Lab
Gene Symbol Anxa3
Ensembl Gene ENSMUSG00000029484
Gene Nameannexin A3
SynonymsAnx3
MMRRC Submission 038906-MU
Accession Numbers

Genbank: NM_013470; MGI: 1201378; Ensembl: ENSMUST00000112985

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0724 (G1)
Quality Score21
Status Validated
Chromosome5
Chromosomal Location96793339-96845966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96828748 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 198 (T198A)
Ref Sequence ENSEMBL: ENSMUSP00000031447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031447] [ENSMUST00000198631] [ENSMUST00000200379]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031447
AA Change: T198A

PolyPhen 2 Score 0.703 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000031447
Gene: ENSMUSG00000029484
AA Change: T198A

DomainStartEndE-ValueType
ANX 35 87 5.74e-24 SMART
ANX 107 159 1.67e-25 SMART
ANX 191 243 3.67e-22 SMART
ANX 266 318 2.87e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197339
Predicted Effect probably benign
Transcript: ENSMUST00000198631
SMART Domains Protein: ENSMUSP00000143491
Gene: ENSMUSG00000029484

DomainStartEndE-ValueType
ANX 35 87 5.74e-24 SMART
ANX 107 159 1.67e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199656
Predicted Effect probably benign
Transcript: ENSMUST00000200379
SMART Domains Protein: ENSMUSP00000142527
Gene: ENSMUSG00000029484

DomainStartEndE-ValueType
ANX 24 76 7.2e-28 SMART
Meta Mutation Damage Score 0.0963 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the annexin family. Members of this calcium-dependent phospholipid-binding protein family play a role in the regulation of cellular growth and in signal transduction pathways. This protein functions in the inhibition of phopholipase A2 and cleavage of inositol 1,2-cyclic phosphate to form inositol 1-phosphate. This protein may also play a role in anti-coagulation. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 145,044,763 E136G probably benign Het
Adgre4 T A 17: 55,852,281 S655R probably benign Het
Ak7 T A 12: 105,710,254 V71E probably benign Het
Ank2 C T 3: 126,962,337 R1077H probably damaging Het
Atp1a1 A T 3: 101,592,439 I109N possibly damaging Het
Camta1 A G 4: 151,077,892 I119T probably damaging Het
Carm1 A G 9: 21,587,374 Y504C probably damaging Het
Casp1 C T 9: 5,303,077 P177L probably benign Het
Ccdc122 C A 14: 77,092,077 probably benign Het
Ces1a A G 8: 93,039,513 S158P probably damaging Het
Ces3a T A 8: 105,050,195 D103E possibly damaging Het
Clstn1 A C 4: 149,643,624 D583A possibly damaging Het
Corin A G 5: 72,332,795 probably benign Het
Cryba1 T C 11: 77,719,457 D144G probably damaging Het
Cwf19l2 G T 9: 3,421,377 probably null Het
Dis3l T C 9: 64,307,126 T1027A possibly damaging Het
Dopey2 A G 16: 93,762,325 E653G probably benign Het
Dst A G 1: 34,188,677 I1459V probably benign Het
Dyrk3 T C 1: 131,130,140 T64A probably benign Het
Emp2 C T 16: 10,284,615 C111Y probably benign Het
Enam A G 5: 88,501,994 Y454C probably damaging Het
Fbn1 A T 2: 125,352,064 C1328S probably benign Het
Gata3 T C 2: 9,874,575 T197A probably benign Het
Gm1043 A G 5: 37,187,229 T212A probably damaging Het
Gm15448 T C 7: 3,816,872 N564S possibly damaging Het
H2-Eb1 T C 17: 34,315,032 probably benign Het
Hand1 T C 11: 57,831,680 H36R probably damaging Het
Hmgcs2 C A 3: 98,297,001 Y239* probably null Het
Hoxc12 A G 15: 102,937,055 Y68C probably damaging Het
Inpp5a A G 7: 139,516,663 I143V probably benign Het
Klhdc2 C A 12: 69,297,048 F18L probably benign Het
Kpnb1 T C 11: 97,178,304 Y251C probably damaging Het
Lrch4 A T 5: 137,637,308 N315I probably damaging Het
Map3k10 A C 7: 27,668,355 V286G probably damaging Het
Myo7b G A 18: 32,005,549 probably benign Het
Nlrp2 G T 7: 5,319,222 L809I probably damaging Het
Oacyl T C 18: 65,737,825 probably benign Het
Olfr735 A G 14: 50,345,917 V175A possibly damaging Het
Paxbp1 T A 16: 91,036,536 D270V probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Plcb3 G A 19: 6,963,392 R359C probably damaging Het
Plcxd3 G A 15: 4,516,868 S118N probably damaging Het
Ptpn14 T C 1: 189,850,947 S664P possibly damaging Het
Sirt1 T C 10: 63,323,973 I443V possibly damaging Het
Slc7a8 G A 14: 54,735,186 probably benign Het
Smim14 A G 5: 65,453,339 probably benign Het
Sost C T 11: 101,966,918 C19Y probably benign Het
Tcaf1 G T 6: 42,675,367 A727E probably damaging Het
Thoc1 T C 18: 9,963,829 L144P probably damaging Het
Tmem132b A T 5: 125,783,421 T577S possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tshr T C 12: 91,538,286 F666S probably damaging Het
Wdr1 A G 5: 38,540,862 V192A possibly damaging Het
Zfp697 T C 3: 98,428,166 W416R probably damaging Het
Other mutations in Anxa3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01984:Anxa3 APN 5 96834771 splice site probably benign
IGL03243:Anxa3 APN 5 96828692 unclassified probably benign
F6893:Anxa3 UTSW 5 96824994 unclassified probably benign
R0026:Anxa3 UTSW 5 96838401 missense probably benign 0.01
R0468:Anxa3 UTSW 5 96811099 missense probably benign 0.00
R0562:Anxa3 UTSW 5 96812884 missense possibly damaging 0.90
R1442:Anxa3 UTSW 5 96828690 splice site probably null
R2276:Anxa3 UTSW 5 96830490 critical splice donor site probably null
R4922:Anxa3 UTSW 5 96820429 missense probably damaging 1.00
R5108:Anxa3 UTSW 5 96830414 missense possibly damaging 0.83
R5230:Anxa3 UTSW 5 96838312 missense possibly damaging 0.47
R5529:Anxa3 UTSW 5 96828379 missense probably benign 0.00
R5733:Anxa3 UTSW 5 96820472 missense probably damaging 1.00
R5857:Anxa3 UTSW 5 96828792 critical splice donor site probably null
R5902:Anxa3 UTSW 5 96812853 nonsense probably null
R6558:Anxa3 UTSW 5 96812939 splice site probably null
R6772:Anxa3 UTSW 5 96811113 missense probably damaging 0.98
R7425:Anxa3 UTSW 5 96834821 missense probably benign 0.30
R7515:Anxa3 UTSW 5 96838320 missense probably damaging 1.00
R7619:Anxa3 UTSW 5 96830404 missense probably damaging 1.00
R8018:Anxa3 UTSW 5 96820429 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGTGTCAAGCATCCACCATTCC -3'
(R):5'- GTTCTCATCTAGAGTGCCGCACAG -3'

Sequencing Primer
(F):5'- AGGTCCTGTATTTGACCTTCAG -3'
(R):5'- CCTGCTAAGTCTTTAGGGCAAAAC -3'
Posted On2015-02-04