Incidental Mutation 'R0724:Gm15448'
List |< first << previous [record 26 of 55] next >> last >|
ID262010
Institutional Source Beutler Lab
Gene Symbol Gm15448
Ensembl Gene ENSMUSG00000074419
Gene Namepredicted gene 15448
SynonymsENSMUSG00000074419
MMRRC Submission 038906-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R0724 (G1)
Quality Score37
Status Validated
Chromosome7
Chromosomal Location3816781-3825687 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3816872 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 564 (N564S)
Ref Sequence ENSEMBL: ENSMUSP00000104260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094911] [ENSMUST00000108619] [ENSMUST00000108620] [ENSMUST00000153846] [ENSMUST00000189095]
Predicted Effect probably benign
Transcript: ENSMUST00000094911
SMART Domains Protein: ENSMUSP00000092515
Gene: ENSMUSG00000074419

DomainStartEndE-ValueType
IG_like 40 105 3.26e0 SMART
IG 129 315 1.37e-1 SMART
IG_like 237 302 2.2e-1 SMART
IG 328 415 6.31e-1 SMART
IG 430 519 8.01e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000108619
AA Change: N665S
SMART Domains Protein: ENSMUSP00000104259
Gene: ENSMUSG00000074419
AA Change: N665S

DomainStartEndE-ValueType
IG_like 40 105 3.26e0 SMART
IG 129 315 1.37e-1 SMART
IG_like 237 302 2.2e-1 SMART
IG 328 415 6.31e-1 SMART
IG_like 429 517 6.02e0 SMART
IG 529 618 8.01e-3 SMART
low complexity region 637 646 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108620
AA Change: N564S

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104260
Gene: ENSMUSG00000074419
AA Change: N564S

DomainStartEndE-ValueType
IG_like 40 105 3.26e0 SMART
IG 129 315 1.37e-1 SMART
IG_like 237 302 2.2e-1 SMART
IG 328 415 6.31e-1 SMART
IG 430 519 8.01e-3 SMART
low complexity region 538 547 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000153846
AA Change: N682S
SMART Domains Protein: ENSMUSP00000121707
Gene: ENSMUSG00000074419
AA Change: N682S

DomainStartEndE-ValueType
IG 7 96 8.01e-3 SMART
low complexity region 132 141 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189095
SMART Domains Protein: ENSMUSP00000140974
Gene: ENSMUSG00000074419

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG_like 40 105 1.3e-2 SMART
IG 129 315 5.7e-4 SMART
IG_like 237 302 9e-4 SMART
IG 328 415 2.6e-3 SMART
IG_like 429 517 2.4e-2 SMART
IG 529 618 3.3e-5 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 145,044,763 E136G probably benign Het
Adgre4 T A 17: 55,852,281 S655R probably benign Het
Ak7 T A 12: 105,710,254 V71E probably benign Het
Ank2 C T 3: 126,962,337 R1077H probably damaging Het
Anxa3 A G 5: 96,828,748 T198A possibly damaging Het
Atp1a1 A T 3: 101,592,439 I109N possibly damaging Het
Camta1 A G 4: 151,077,892 I119T probably damaging Het
Carm1 A G 9: 21,587,374 Y504C probably damaging Het
Casp1 C T 9: 5,303,077 P177L probably benign Het
Ccdc122 C A 14: 77,092,077 probably benign Het
Ces1a A G 8: 93,039,513 S158P probably damaging Het
Ces3a T A 8: 105,050,195 D103E possibly damaging Het
Clstn1 A C 4: 149,643,624 D583A possibly damaging Het
Corin A G 5: 72,332,795 probably benign Het
Cryba1 T C 11: 77,719,457 D144G probably damaging Het
Cwf19l2 G T 9: 3,421,377 probably null Het
Dis3l T C 9: 64,307,126 T1027A possibly damaging Het
Dopey2 A G 16: 93,762,325 E653G probably benign Het
Dst A G 1: 34,188,677 I1459V probably benign Het
Dyrk3 T C 1: 131,130,140 T64A probably benign Het
Emp2 C T 16: 10,284,615 C111Y probably benign Het
Enam A G 5: 88,501,994 Y454C probably damaging Het
Fbn1 A T 2: 125,352,064 C1328S probably benign Het
Gata3 T C 2: 9,874,575 T197A probably benign Het
Gm1043 A G 5: 37,187,229 T212A probably damaging Het
H2-Eb1 T C 17: 34,315,032 probably benign Het
Hand1 T C 11: 57,831,680 H36R probably damaging Het
Hmgcs2 C A 3: 98,297,001 Y239* probably null Het
Hoxc12 A G 15: 102,937,055 Y68C probably damaging Het
Inpp5a A G 7: 139,516,663 I143V probably benign Het
Klhdc2 C A 12: 69,297,048 F18L probably benign Het
Kpnb1 T C 11: 97,178,304 Y251C probably damaging Het
Lrch4 A T 5: 137,637,308 N315I probably damaging Het
Map3k10 A C 7: 27,668,355 V286G probably damaging Het
Myo7b G A 18: 32,005,549 probably benign Het
Nlrp2 G T 7: 5,319,222 L809I probably damaging Het
Oacyl T C 18: 65,737,825 probably benign Het
Olfr735 A G 14: 50,345,917 V175A possibly damaging Het
Paxbp1 T A 16: 91,036,536 D270V probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Plcb3 G A 19: 6,963,392 R359C probably damaging Het
Plcxd3 G A 15: 4,516,868 S118N probably damaging Het
Ptpn14 T C 1: 189,850,947 S664P possibly damaging Het
Sirt1 T C 10: 63,323,973 I443V possibly damaging Het
Slc7a8 G A 14: 54,735,186 probably benign Het
Smim14 A G 5: 65,453,339 probably benign Het
Sost C T 11: 101,966,918 C19Y probably benign Het
Tcaf1 G T 6: 42,675,367 A727E probably damaging Het
Thoc1 T C 18: 9,963,829 L144P probably damaging Het
Tmem132b A T 5: 125,783,421 T577S possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tshr T C 12: 91,538,286 F666S probably damaging Het
Wdr1 A G 5: 38,540,862 V192A possibly damaging Het
Zfp697 T C 3: 98,428,166 W416R probably damaging Het
Other mutations in Gm15448
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Gm15448 APN 7 3823089 missense probably damaging 1.00
IGL01675:Gm15448 APN 7 3822608 splice site probably benign
IGL02040:Gm15448 APN 7 3821517 splice site probably benign
IGL02547:Gm15448 APN 7 3821661 missense probably damaging 0.98
IGL02749:Gm15448 APN 7 3822625 missense probably damaging 1.00
IGL02822:Gm15448 APN 7 3816918 missense possibly damaging 0.50
IGL02883:Gm15448 APN 7 3822180 missense possibly damaging 0.95
IGL03140:Gm15448 APN 7 3823248 missense probably benign 0.00
IGL03185:Gm15448 APN 7 3823230 missense probably damaging 1.00
IGL03212:Gm15448 APN 7 3823133 missense probably benign 0.00
R0347:Gm15448 UTSW 7 3822874 missense probably damaging 1.00
R0652:Gm15448 UTSW 7 3822763 missense probably benign 0.02
R0668:Gm15448 UTSW 7 3822700 missense probably damaging 0.99
R0735:Gm15448 UTSW 7 3821782 missense possibly damaging 0.79
R1074:Gm15448 UTSW 7 3823070 missense probably damaging 1.00
R1339:Gm15448 UTSW 7 3822156 missense probably damaging 1.00
R1541:Gm15448 UTSW 7 3816989 missense probably damaging 1.00
R1570:Gm15448 UTSW 7 3823061 missense probably benign 0.45
R1880:Gm15448 UTSW 7 3824951 critical splice donor site probably null
R1892:Gm15448 UTSW 7 3824574 missense probably benign 0.15
R1909:Gm15448 UTSW 7 3822919 missense probably benign 0.31
R2881:Gm15448 UTSW 7 3825641 start codon destroyed probably null 0.98
R2967:Gm15448 UTSW 7 3822687 missense probably damaging 1.00
R2983:Gm15448 UTSW 7 3821575 missense probably damaging 1.00
R4213:Gm15448 UTSW 7 3821554 missense probably damaging 1.00
R4319:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4320:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4321:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4322:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4323:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4536:Gm15448 UTSW 7 3822252 missense probably benign 0.00
R4597:Gm15448 UTSW 7 3822155 missense possibly damaging 0.81
R4713:Gm15448 UTSW 7 3822681 nonsense probably null
R4725:Gm15448 UTSW 7 3821548 missense probably benign
R4934:Gm15448 UTSW 7 3822677 missense probably damaging 1.00
R4971:Gm15448 UTSW 7 3822806 missense probably benign 0.00
R5138:Gm15448 UTSW 7 3824557 nonsense probably null
R5805:Gm15448 UTSW 7 3822623 missense probably benign 0.15
R5824:Gm15448 UTSW 7 3824754 missense probably damaging 1.00
R5841:Gm15448 UTSW 7 3822899 nonsense probably null
R6027:Gm15448 UTSW 7 3824639 missense possibly damaging 0.94
R6214:Gm15448 UTSW 7 3821718 missense probably damaging 0.99
R6329:Gm15448 UTSW 7 3822851 missense probably damaging 1.00
R6429:Gm15448 UTSW 7 3822346 missense possibly damaging 0.63
R6650:Gm15448 UTSW 7 3816899 missense possibly damaging 0.83
R6681:Gm15448 UTSW 7 3822252 missense probably benign 0.00
R6961:Gm15448 UTSW 7 3825125 missense probably damaging 1.00
R6989:Gm15448 UTSW 7 3822164 missense possibly damaging 0.95
R7025:Gm15448 UTSW 7 3821262 nonsense probably null
R7071:Gm15448 UTSW 7 3821668 missense unknown
R7194:Gm15448 UTSW 7 3824793 missense
R7215:Gm15448 UTSW 7 3822311 missense unknown
R7580:Gm15448 UTSW 7 3824612 missense unknown
R7776:Gm15448 UTSW 7 3823247 missense unknown
R7863:Gm15448 UTSW 7 3824802 critical splice acceptor site probably null
R7909:Gm15448 UTSW 7 3821709 missense unknown
R7946:Gm15448 UTSW 7 3824802 critical splice acceptor site probably null
R7990:Gm15448 UTSW 7 3821709 missense unknown
R8131:Gm15448 UTSW 7 3822162 nonsense probably null
R8178:Gm15448 UTSW 7 3821261 missense unknown
R8188:Gm15448 UTSW 7 3823127 missense unknown
R8220:Gm15448 UTSW 7 3822904 missense unknown
R8226:Gm15448 UTSW 7 3825110 missense
Predicted Primers PCR Primer
(F):5'- GGTTCAGGAAACAAAGGCTCCCAG -3'
(R):5'- TGGAACTCAGAAGAAACACTACGGC -3'

Sequencing Primer
(F):5'- TGAGGAAGCACCTCATTATGAC -3'
(R):5'- AGAGTAGAACCTTGTCATCTCCG -3'
Posted On2015-02-04