Incidental Mutation 'R0724:Map3k10'
List |< first << previous [record 35 of 55] next >> last >|
ID262011
Institutional Source Beutler Lab
Gene Symbol Map3k10
Ensembl Gene ENSMUSG00000040390
Gene Namemitogen-activated protein kinase kinase kinase 10
SynonymsMlk2, serine/threonine kinase, MKN28 derived nonreceptor_type, mixed lineage kinase 2, MKN28 kinase
MMRRC Submission 038906-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0724 (G1)
Quality Score43
Status Validated
Chromosome7
Chromosomal Location27656375-27674598 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 27668355 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 286 (V286G)
Ref Sequence ENSEMBL: ENSMUSP00000146275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036453] [ENSMUST00000108341] [ENSMUST00000138243]
Predicted Effect probably damaging
Transcript: ENSMUST00000036453
AA Change: V286G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037725
Gene: ENSMUSG00000040390
AA Change: V286G

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
SH3 19 80 6e-20 SMART
Pfam:Pkinase 98 357 7.4e-59 PFAM
Pfam:Pkinase_Tyr 98 357 3.8e-62 PFAM
coiled coil region 378 449 N/A INTRINSIC
low complexity region 501 511 N/A INTRINSIC
low complexity region 524 550 N/A INTRINSIC
low complexity region 665 676 N/A INTRINSIC
low complexity region 761 778 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108341
AA Change: V286G

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103978
Gene: ENSMUSG00000040390
AA Change: V286G

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
SH3 19 80 6e-20 SMART
Pfam:Pkinase_Tyr 98 357 2e-62 PFAM
Pfam:Pkinase 98 358 4.8e-59 PFAM
coiled coil region 378 449 N/A INTRINSIC
low complexity region 501 511 N/A INTRINSIC
low complexity region 524 550 N/A INTRINSIC
low complexity region 665 676 N/A INTRINSIC
low complexity region 761 778 N/A INTRINSIC
low complexity region 837 849 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133551
Predicted Effect probably damaging
Transcript: ENSMUST00000138243
AA Change: V286G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152032
Meta Mutation Damage Score 0.9350 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine kinase family. This kinase has been shown to activate MAPK8/JNK and MKK4/SEK1, and this kinase itself can be phoshorylated, and thus activated by JNK kinases. This kinase functions preferentially on the JNK signaling pathway, and is reported to be involved in nerve growth factor (NGF) induced neuronal apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit normal development, reproduction and lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 145,044,763 E136G probably benign Het
Adgre4 T A 17: 55,852,281 S655R probably benign Het
Ak7 T A 12: 105,710,254 V71E probably benign Het
Ank2 C T 3: 126,962,337 R1077H probably damaging Het
Anxa3 A G 5: 96,828,748 T198A possibly damaging Het
Atp1a1 A T 3: 101,592,439 I109N possibly damaging Het
Camta1 A G 4: 151,077,892 I119T probably damaging Het
Carm1 A G 9: 21,587,374 Y504C probably damaging Het
Casp1 C T 9: 5,303,077 P177L probably benign Het
Ccdc122 C A 14: 77,092,077 probably benign Het
Ces1a A G 8: 93,039,513 S158P probably damaging Het
Ces3a T A 8: 105,050,195 D103E possibly damaging Het
Clstn1 A C 4: 149,643,624 D583A possibly damaging Het
Corin A G 5: 72,332,795 probably benign Het
Cryba1 T C 11: 77,719,457 D144G probably damaging Het
Cwf19l2 G T 9: 3,421,377 probably null Het
Dis3l T C 9: 64,307,126 T1027A possibly damaging Het
Dopey2 A G 16: 93,762,325 E653G probably benign Het
Dst A G 1: 34,188,677 I1459V probably benign Het
Dyrk3 T C 1: 131,130,140 T64A probably benign Het
Emp2 C T 16: 10,284,615 C111Y probably benign Het
Enam A G 5: 88,501,994 Y454C probably damaging Het
Fbn1 A T 2: 125,352,064 C1328S probably benign Het
Gata3 T C 2: 9,874,575 T197A probably benign Het
Gm1043 A G 5: 37,187,229 T212A probably damaging Het
Gm15448 T C 7: 3,816,872 N564S possibly damaging Het
H2-Eb1 T C 17: 34,315,032 probably benign Het
Hand1 T C 11: 57,831,680 H36R probably damaging Het
Hmgcs2 C A 3: 98,297,001 Y239* probably null Het
Hoxc12 A G 15: 102,937,055 Y68C probably damaging Het
Inpp5a A G 7: 139,516,663 I143V probably benign Het
Klhdc2 C A 12: 69,297,048 F18L probably benign Het
Kpnb1 T C 11: 97,178,304 Y251C probably damaging Het
Lrch4 A T 5: 137,637,308 N315I probably damaging Het
Myo7b G A 18: 32,005,549 probably benign Het
Nlrp2 G T 7: 5,319,222 L809I probably damaging Het
Oacyl T C 18: 65,737,825 probably benign Het
Olfr735 A G 14: 50,345,917 V175A possibly damaging Het
Paxbp1 T A 16: 91,036,536 D270V probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Plcb3 G A 19: 6,963,392 R359C probably damaging Het
Plcxd3 G A 15: 4,516,868 S118N probably damaging Het
Ptpn14 T C 1: 189,850,947 S664P possibly damaging Het
Sirt1 T C 10: 63,323,973 I443V possibly damaging Het
Slc7a8 G A 14: 54,735,186 probably benign Het
Smim14 A G 5: 65,453,339 probably benign Het
Sost C T 11: 101,966,918 C19Y probably benign Het
Tcaf1 G T 6: 42,675,367 A727E probably damaging Het
Thoc1 T C 18: 9,963,829 L144P probably damaging Het
Tmem132b A T 5: 125,783,421 T577S possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tshr T C 12: 91,538,286 F666S probably damaging Het
Wdr1 A G 5: 38,540,862 V192A possibly damaging Het
Zfp697 T C 3: 98,428,166 W416R probably damaging Het
Other mutations in Map3k10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Map3k10 APN 7 27668469 missense probably damaging 1.00
IGL00672:Map3k10 APN 7 27661601 missense probably damaging 0.98
IGL00913:Map3k10 APN 7 27663215 unclassified probably benign
IGL01383:Map3k10 APN 7 27657999 missense probably benign 0.15
IGL02683:Map3k10 APN 7 27658937 missense probably damaging 1.00
R0039:Map3k10 UTSW 7 27658098 missense possibly damaging 0.95
R0219:Map3k10 UTSW 7 27656731 missense probably damaging 1.00
R0285:Map3k10 UTSW 7 27673900 missense probably benign 0.00
R0368:Map3k10 UTSW 7 27663360 missense probably damaging 0.98
R0729:Map3k10 UTSW 7 27661567 missense probably damaging 1.00
R1734:Map3k10 UTSW 7 27658115 missense probably damaging 1.00
R1847:Map3k10 UTSW 7 27661556 unclassified probably null
R2395:Map3k10 UTSW 7 27673993 missense unknown
R2517:Map3k10 UTSW 7 27663263 missense possibly damaging 0.92
R3841:Map3k10 UTSW 7 27658364 missense possibly damaging 0.91
R4749:Map3k10 UTSW 7 27658361 missense possibly damaging 0.78
R5269:Map3k10 UTSW 7 27658532 missense probably benign 0.01
R5822:Map3k10 UTSW 7 27656734 missense probably damaging 1.00
R6059:Map3k10 UTSW 7 27656822 missense probably damaging 0.99
R6417:Map3k10 UTSW 7 27663284 missense probably damaging 1.00
R6420:Map3k10 UTSW 7 27663284 missense probably damaging 1.00
R7903:Map3k10 UTSW 7 27657957 missense probably damaging 0.99
R7986:Map3k10 UTSW 7 27657957 missense probably damaging 0.99
R8118:Map3k10 UTSW 7 27673417 missense possibly damaging 0.91
X0020:Map3k10 UTSW 7 27664462 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTACAAGAATGGCTGCATCCAG -3'
(R):5'- TGAAGAAGGCCATCCCTCAGGAAG -3'

Sequencing Primer
(F):5'- TTCAATGACTACGCAGTGGG -3'
(R):5'- GTGGGGACCCATAACCTATTG -3'
Posted On2015-02-04