Incidental Mutation 'R0724:Sirt1'
List |< first << previous [record 45 of 55] next >> last >|
ID262013
Institutional Source Beutler Lab
Gene Symbol Sirt1
Ensembl Gene ENSMUSG00000020063
Gene Namesirtuin 1
SynonymsSir2, Sir2alpha
MMRRC Submission 038906-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0724 (G1)
Quality Score79
Status Validated
Chromosome10
Chromosomal Location63319005-63381704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63323973 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 443 (I443V)
Ref Sequence ENSEMBL: ENSMUSP00000137565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020257] [ENSMUST00000105442] [ENSMUST00000120239] [ENSMUST00000146028] [ENSMUST00000177694]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020257
AA Change: I443V

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020257
Gene: ENSMUSG00000020063
AA Change: I443V

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 46 94 N/A INTRINSIC
low complexity region 108 131 N/A INTRINSIC
low complexity region 136 148 N/A INTRINSIC
Pfam:SIR2 253 439 1.3e-62 PFAM
PDB:4KXQ|B 629 648 4e-6 PDB
low complexity region 649 667 N/A INTRINSIC
low complexity region 672 687 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105442
AA Change: I404V

PolyPhen 2 Score 0.437 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101082
Gene: ENSMUSG00000020063
AA Change: I404V

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 46 94 N/A INTRINSIC
low complexity region 108 131 N/A INTRINSIC
Pfam:SIR2 214 400 4e-63 PFAM
PDB:4KXQ|B 590 609 3e-6 PDB
low complexity region 610 628 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
low complexity region 663 674 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120239
AA Change: I443V

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112595
Gene: ENSMUSG00000020063
AA Change: I443V

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 46 94 N/A INTRINSIC
low complexity region 108 131 N/A INTRINSIC
low complexity region 136 148 N/A INTRINSIC
Pfam:SIR2 253 439 6.5e-64 PFAM
PDB:4KXQ|B 629 648 4e-6 PDB
low complexity region 649 667 N/A INTRINSIC
low complexity region 672 687 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146028
SMART Domains Protein: ENSMUSP00000117819
Gene: ENSMUSG00000020063

DomainStartEndE-ValueType
Pfam:SIR2 83 140 1.9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148516
Predicted Effect possibly damaging
Transcript: ENSMUST00000177694
AA Change: I443V

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137565
Gene: ENSMUSG00000020063
AA Change: I443V

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 46 94 N/A INTRINSIC
low complexity region 108 131 N/A INTRINSIC
low complexity region 136 148 N/A INTRINSIC
Pfam:SIR2 253 439 7.3e-63 PFAM
low complexity region 465 483 N/A INTRINSIC
low complexity region 488 503 N/A INTRINSIC
low complexity region 518 529 N/A INTRINSIC
Meta Mutation Damage Score 0.3325 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: This gene encodes a member of the sirtuin family of proteins, characterized by their deacetylase activity and proposed role in longevity. The encoded protein regulates gene expression in a wide range of cell and tissue types through its NAD+-dependent deacetylation of histones, transcription factors and transcriptional coactivators. Brain-specific overexpression of this gene has been shown to result in increased median lifespan. Viability of homozygous knockout mice for this gene varies with strain background. Homozygous knockout mice of strains that do not exhibit embryonic lethality are sterile and have a reduced lifespan. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele show embryonic and fetal lethality, abnormal embryogenesis, and abnormal cellular phenotypes of derived MEFs. Mice homozygous for other knock-out alleles may exhibit peri- and postnatal lethality and heart, mammary gland, eye, and reproductive system anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 145,044,763 E136G probably benign Het
Adgre4 T A 17: 55,852,281 S655R probably benign Het
Ak7 T A 12: 105,710,254 V71E probably benign Het
Ank2 C T 3: 126,962,337 R1077H probably damaging Het
Anxa3 A G 5: 96,828,748 T198A possibly damaging Het
Atp1a1 A T 3: 101,592,439 I109N possibly damaging Het
Camta1 A G 4: 151,077,892 I119T probably damaging Het
Carm1 A G 9: 21,587,374 Y504C probably damaging Het
Casp1 C T 9: 5,303,077 P177L probably benign Het
Ccdc122 C A 14: 77,092,077 probably benign Het
Ces1a A G 8: 93,039,513 S158P probably damaging Het
Ces3a T A 8: 105,050,195 D103E possibly damaging Het
Clstn1 A C 4: 149,643,624 D583A possibly damaging Het
Corin A G 5: 72,332,795 probably benign Het
Cryba1 T C 11: 77,719,457 D144G probably damaging Het
Cwf19l2 G T 9: 3,421,377 probably null Het
Dis3l T C 9: 64,307,126 T1027A possibly damaging Het
Dopey2 A G 16: 93,762,325 E653G probably benign Het
Dst A G 1: 34,188,677 I1459V probably benign Het
Dyrk3 T C 1: 131,130,140 T64A probably benign Het
Emp2 C T 16: 10,284,615 C111Y probably benign Het
Enam A G 5: 88,501,994 Y454C probably damaging Het
Fbn1 A T 2: 125,352,064 C1328S probably benign Het
Gata3 T C 2: 9,874,575 T197A probably benign Het
Gm1043 A G 5: 37,187,229 T212A probably damaging Het
Gm15448 T C 7: 3,816,872 N564S possibly damaging Het
H2-Eb1 T C 17: 34,315,032 probably benign Het
Hand1 T C 11: 57,831,680 H36R probably damaging Het
Hmgcs2 C A 3: 98,297,001 Y239* probably null Het
Hoxc12 A G 15: 102,937,055 Y68C probably damaging Het
Inpp5a A G 7: 139,516,663 I143V probably benign Het
Klhdc2 C A 12: 69,297,048 F18L probably benign Het
Kpnb1 T C 11: 97,178,304 Y251C probably damaging Het
Lrch4 A T 5: 137,637,308 N315I probably damaging Het
Map3k10 A C 7: 27,668,355 V286G probably damaging Het
Myo7b G A 18: 32,005,549 probably benign Het
Nlrp2 G T 7: 5,319,222 L809I probably damaging Het
Oacyl T C 18: 65,737,825 probably benign Het
Olfr735 A G 14: 50,345,917 V175A possibly damaging Het
Paxbp1 T A 16: 91,036,536 D270V probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Plcb3 G A 19: 6,963,392 R359C probably damaging Het
Plcxd3 G A 15: 4,516,868 S118N probably damaging Het
Ptpn14 T C 1: 189,850,947 S664P possibly damaging Het
Slc7a8 G A 14: 54,735,186 probably benign Het
Smim14 A G 5: 65,453,339 probably benign Het
Sost C T 11: 101,966,918 C19Y probably benign Het
Tcaf1 G T 6: 42,675,367 A727E probably damaging Het
Thoc1 T C 18: 9,963,829 L144P probably damaging Het
Tmem132b A T 5: 125,783,421 T577S possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tshr T C 12: 91,538,286 F666S probably damaging Het
Wdr1 A G 5: 38,540,862 V192A possibly damaging Het
Zfp697 T C 3: 98,428,166 W416R probably damaging Het
Other mutations in Sirt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02057:Sirt1 APN 10 63325203 missense probably damaging 1.00
IGL02106:Sirt1 APN 10 63335829 missense probably damaging 1.00
PIT4283001:Sirt1 UTSW 10 63321786 missense probably benign 0.02
R0658:Sirt1 UTSW 10 63321736 unclassified probably benign
R1653:Sirt1 UTSW 10 63321809 missense probably benign
R1831:Sirt1 UTSW 10 63320646 missense probably benign 0.13
R4133:Sirt1 UTSW 10 63335659 missense probably null 0.42
R4250:Sirt1 UTSW 10 63337098 critical splice acceptor site probably null
R4378:Sirt1 UTSW 10 63338949 missense probably benign 0.00
R4396:Sirt1 UTSW 10 63321998 missense probably benign 0.00
R4776:Sirt1 UTSW 10 63335722 missense probably benign 0.17
R4898:Sirt1 UTSW 10 63322004 missense probably benign 0.35
R7151:Sirt1 UTSW 10 63323996 missense probably damaging 1.00
R7365:Sirt1 UTSW 10 63322003 missense probably benign
R7467:Sirt1 UTSW 10 63322150 missense probably benign 0.00
R7773:Sirt1 UTSW 10 63326783 missense possibly damaging 0.75
RF015:Sirt1 UTSW 10 63337016 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGACCTCTGCAACTTTAATATGCAC -3'
(R):5'- TGAGCCACTTGCCATCATGAAGC -3'

Sequencing Primer
(F):5'- CATGCGTCAAACAGTTTTGC -3'
(R):5'- CATCATGAAGCCAGAGATTGTC -3'
Posted On2015-02-04