Incidental Mutation 'R0724:Kpnb1'
Institutional Source Beutler Lab
Gene Symbol Kpnb1
Ensembl Gene ENSMUSG00000001440
Gene Namekaryopherin (importin) beta 1
MMRRC Submission 038906-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0724 (G1)
Quality Score32
Status Validated
Chromosomal Location97159714-97187881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97178304 bp
Amino Acid Change Tyrosine to Cysteine at position 251 (Y251C)
Ref Sequence ENSEMBL: ENSMUSP00000001479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001479]
Crystal structure of Importin-beta and SREBP-2 complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000001479
AA Change: Y251C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001479
Gene: ENSMUSG00000001440
AA Change: Y251C

IBN_N 21 101 3.72e-5 SMART
Blast:ARM 158 203 4e-7 BLAST
Pfam:HEAT_EZ 380 435 3e-13 PFAM
Pfam:HEAT 409 439 2.6e-7 PFAM
Blast:ARM 440 477 7e-17 BLAST
low complexity region 478 495 N/A INTRINSIC
Blast:IBN_N 528 590 9e-25 BLAST
Blast:ARM 594 637 1e-18 BLAST
Blast:ARM 784 827 1e-5 BLAST
Meta Mutation Damage Score 0.3774 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleocytoplasmic transport, a signal- and energy-dependent process, takes place through nuclear pore complexes embedded in the nuclear envelope. The import of proteins containing a nuclear localization signal (NLS) requires the NLS import receptor, a heterodimer of importin alpha and beta subunits also known as karyopherins. Importin alpha binds the NLS-containing cargo in the cytoplasm and importin beta docks the complex at the cytoplasmic side of the nuclear pore complex. In the presence of nucleoside triphosphates and the small GTP binding protein Ran, the complex moves into the nuclear pore complex and the importin subunits dissociate. Importin alpha enters the nucleoplasm with its passenger protein and importin beta remains at the pore. Interactions between importin beta and the FG repeats of nucleoporins are essential in translocation through the pore complex. The protein encoded by this gene is a member of the importin beta family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Homozygous mutation of this gene results in lethality shortly after implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 145,044,763 E136G probably benign Het
Adgre4 T A 17: 55,852,281 S655R probably benign Het
Ak7 T A 12: 105,710,254 V71E probably benign Het
Ank2 C T 3: 126,962,337 R1077H probably damaging Het
Anxa3 A G 5: 96,828,748 T198A possibly damaging Het
Atp1a1 A T 3: 101,592,439 I109N possibly damaging Het
Camta1 A G 4: 151,077,892 I119T probably damaging Het
Carm1 A G 9: 21,587,374 Y504C probably damaging Het
Casp1 C T 9: 5,303,077 P177L probably benign Het
Ccdc122 C A 14: 77,092,077 probably benign Het
Ces1a A G 8: 93,039,513 S158P probably damaging Het
Ces3a T A 8: 105,050,195 D103E possibly damaging Het
Clstn1 A C 4: 149,643,624 D583A possibly damaging Het
Corin A G 5: 72,332,795 probably benign Het
Cryba1 T C 11: 77,719,457 D144G probably damaging Het
Cwf19l2 G T 9: 3,421,377 probably null Het
Dis3l T C 9: 64,307,126 T1027A possibly damaging Het
Dopey2 A G 16: 93,762,325 E653G probably benign Het
Dst A G 1: 34,188,677 I1459V probably benign Het
Dyrk3 T C 1: 131,130,140 T64A probably benign Het
Emp2 C T 16: 10,284,615 C111Y probably benign Het
Enam A G 5: 88,501,994 Y454C probably damaging Het
Fbn1 A T 2: 125,352,064 C1328S probably benign Het
Gata3 T C 2: 9,874,575 T197A probably benign Het
Gm1043 A G 5: 37,187,229 T212A probably damaging Het
Gm15448 T C 7: 3,816,872 N564S possibly damaging Het
H2-Eb1 T C 17: 34,315,032 probably benign Het
Hand1 T C 11: 57,831,680 H36R probably damaging Het
Hmgcs2 C A 3: 98,297,001 Y239* probably null Het
Hoxc12 A G 15: 102,937,055 Y68C probably damaging Het
Inpp5a A G 7: 139,516,663 I143V probably benign Het
Klhdc2 C A 12: 69,297,048 F18L probably benign Het
Lrch4 A T 5: 137,637,308 N315I probably damaging Het
Map3k10 A C 7: 27,668,355 V286G probably damaging Het
Myo7b G A 18: 32,005,549 probably benign Het
Nlrp2 G T 7: 5,319,222 L809I probably damaging Het
Oacyl T C 18: 65,737,825 probably benign Het
Olfr735 A G 14: 50,345,917 V175A possibly damaging Het
Paxbp1 T A 16: 91,036,536 D270V probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Plcb3 G A 19: 6,963,392 R359C probably damaging Het
Plcxd3 G A 15: 4,516,868 S118N probably damaging Het
Ptpn14 T C 1: 189,850,947 S664P possibly damaging Het
Sirt1 T C 10: 63,323,973 I443V possibly damaging Het
Slc7a8 G A 14: 54,735,186 probably benign Het
Smim14 A G 5: 65,453,339 probably benign Het
Sost C T 11: 101,966,918 C19Y probably benign Het
Tcaf1 G T 6: 42,675,367 A727E probably damaging Het
Thoc1 T C 18: 9,963,829 L144P probably damaging Het
Tmem132b A T 5: 125,783,421 T577S possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tshr T C 12: 91,538,286 F666S probably damaging Het
Wdr1 A G 5: 38,540,862 V192A possibly damaging Het
Zfp697 T C 3: 98,428,166 W416R probably damaging Het
Other mutations in Kpnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Kpnb1 APN 11 97166102 missense probably damaging 1.00
IGL01919:Kpnb1 APN 11 97164730 missense probably benign
IGL02161:Kpnb1 APN 11 97168936 missense probably benign 0.01
IGL02679:Kpnb1 APN 11 97177260 missense possibly damaging 0.92
IGL02866:Kpnb1 APN 11 97177286 missense probably damaging 0.99
IGL02899:Kpnb1 APN 11 97175786 missense probably damaging 1.00
R0373:Kpnb1 UTSW 11 97185090 missense probably damaging 1.00
R0542:Kpnb1 UTSW 11 97187572 missense probably benign 0.12
R0825:Kpnb1 UTSW 11 97171675 missense probably damaging 0.98
R0853:Kpnb1 UTSW 11 97187411 missense probably damaging 0.97
R1481:Kpnb1 UTSW 11 97178310 missense probably damaging 1.00
R3802:Kpnb1 UTSW 11 97166129 missense possibly damaging 0.92
R4458:Kpnb1 UTSW 11 97169170 missense probably damaging 1.00
R4490:Kpnb1 UTSW 11 97171598 missense probably benign
R4757:Kpnb1 UTSW 11 97177334 missense possibly damaging 0.65
R5500:Kpnb1 UTSW 11 97173111 missense possibly damaging 0.94
R6360:Kpnb1 UTSW 11 97173270 missense probably benign
R6494:Kpnb1 UTSW 11 97181648 missense probably benign 0.04
R7678:Kpnb1 UTSW 11 97169173 missense probably damaging 1.00
R8171:Kpnb1 UTSW 11 97175747 critical splice donor site probably null
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ccattcatcaggggactcac -3'
Posted On2015-02-04