Incidental Mutation 'R0724:Klhdc2'
List |< first << previous [record 32 of 55] next >> last >|
ID262015
Institutional Source Beutler Lab
Gene Symbol Klhdc2
Ensembl Gene ENSMUSG00000020978
Gene Namekelch domain containing 2
SynonymsHCLP-1, D12Ertd522e, 2310022K15Rik
MMRRC Submission 038906-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0724 (G1)
Quality Score63
Status Validated
Chromosome12
Chromosomal Location69296681-69310687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 69297048 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 18 (F18L)
Ref Sequence ENSEMBL: ENSMUSP00000021362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021362]
Predicted Effect probably benign
Transcript: ENSMUST00000021362
AA Change: F18L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021362
Gene: ENSMUSG00000020978
AA Change: F18L

DomainStartEndE-ValueType
internal_repeat_1 7 117 3.66e-6 PROSPERO
internal_repeat_2 66 163 6.25e-5 PROSPERO
Pfam:Kelch_1 217 258 1.4e-6 PFAM
Pfam:Kelch_2 217 262 1.2e-7 PFAM
Pfam:Kelch_4 217 266 8.4e-8 PFAM
Pfam:Kelch_3 227 276 5.1e-9 PFAM
Pfam:Kelch_5 265 305 1.4e-6 PFAM
Pfam:Kelch_4 267 310 2e-9 PFAM
Pfam:Kelch_3 278 326 1.4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138585
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151571
Meta Mutation Damage Score 0.0633 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 145,044,763 E136G probably benign Het
Adgre4 T A 17: 55,852,281 S655R probably benign Het
Ak7 T A 12: 105,710,254 V71E probably benign Het
Ank2 C T 3: 126,962,337 R1077H probably damaging Het
Anxa3 A G 5: 96,828,748 T198A possibly damaging Het
Atp1a1 A T 3: 101,592,439 I109N possibly damaging Het
Camta1 A G 4: 151,077,892 I119T probably damaging Het
Carm1 A G 9: 21,587,374 Y504C probably damaging Het
Casp1 C T 9: 5,303,077 P177L probably benign Het
Ccdc122 C A 14: 77,092,077 probably benign Het
Ces1a A G 8: 93,039,513 S158P probably damaging Het
Ces3a T A 8: 105,050,195 D103E possibly damaging Het
Clstn1 A C 4: 149,643,624 D583A possibly damaging Het
Corin A G 5: 72,332,795 probably benign Het
Cryba1 T C 11: 77,719,457 D144G probably damaging Het
Cwf19l2 G T 9: 3,421,377 probably null Het
Dis3l T C 9: 64,307,126 T1027A possibly damaging Het
Dopey2 A G 16: 93,762,325 E653G probably benign Het
Dst A G 1: 34,188,677 I1459V probably benign Het
Dyrk3 T C 1: 131,130,140 T64A probably benign Het
Emp2 C T 16: 10,284,615 C111Y probably benign Het
Enam A G 5: 88,501,994 Y454C probably damaging Het
Fbn1 A T 2: 125,352,064 C1328S probably benign Het
Gata3 T C 2: 9,874,575 T197A probably benign Het
Gm1043 A G 5: 37,187,229 T212A probably damaging Het
Gm15448 T C 7: 3,816,872 N564S possibly damaging Het
H2-Eb1 T C 17: 34,315,032 probably benign Het
Hand1 T C 11: 57,831,680 H36R probably damaging Het
Hmgcs2 C A 3: 98,297,001 Y239* probably null Het
Hoxc12 A G 15: 102,937,055 Y68C probably damaging Het
Inpp5a A G 7: 139,516,663 I143V probably benign Het
Kpnb1 T C 11: 97,178,304 Y251C probably damaging Het
Lrch4 A T 5: 137,637,308 N315I probably damaging Het
Map3k10 A C 7: 27,668,355 V286G probably damaging Het
Myo7b G A 18: 32,005,549 probably benign Het
Nlrp2 G T 7: 5,319,222 L809I probably damaging Het
Oacyl T C 18: 65,737,825 probably benign Het
Olfr735 A G 14: 50,345,917 V175A possibly damaging Het
Paxbp1 T A 16: 91,036,536 D270V probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Plcb3 G A 19: 6,963,392 R359C probably damaging Het
Plcxd3 G A 15: 4,516,868 S118N probably damaging Het
Ptpn14 T C 1: 189,850,947 S664P possibly damaging Het
Sirt1 T C 10: 63,323,973 I443V possibly damaging Het
Slc7a8 G A 14: 54,735,186 probably benign Het
Smim14 A G 5: 65,453,339 probably benign Het
Sost C T 11: 101,966,918 C19Y probably benign Het
Tcaf1 G T 6: 42,675,367 A727E probably damaging Het
Thoc1 T C 18: 9,963,829 L144P probably damaging Het
Tmem132b A T 5: 125,783,421 T577S possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tshr T C 12: 91,538,286 F666S probably damaging Het
Wdr1 A G 5: 38,540,862 V192A possibly damaging Het
Zfp697 T C 3: 98,428,166 W416R probably damaging Het
Other mutations in Klhdc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Klhdc2 APN 12 69303534 missense probably benign 0.04
IGL00990:Klhdc2 APN 12 69307213 missense probably benign 0.30
IGL01024:Klhdc2 APN 12 69305836 missense probably benign 0.01
IGL01457:Klhdc2 APN 12 69297053 missense probably benign
IGL01735:Klhdc2 APN 12 69300279 missense probably benign 0.39
IGL01913:Klhdc2 APN 12 69302358 missense probably benign 0.45
IGL02440:Klhdc2 APN 12 69303640 missense probably damaging 1.00
Dixit_dominus UTSW 12 69308976 nonsense probably null
R0611:Klhdc2 UTSW 12 69300279 missense probably benign 0.22
R1350:Klhdc2 UTSW 12 69305710 critical splice donor site probably null
R1796:Klhdc2 UTSW 12 69300297 critical splice donor site probably null
R1907:Klhdc2 UTSW 12 69296960 start gained probably benign
R4418:Klhdc2 UTSW 12 69307597 unclassified probably benign
R5119:Klhdc2 UTSW 12 69296962 utr 5 prime probably benign
R5586:Klhdc2 UTSW 12 69307693 splice site probably null
R5987:Klhdc2 UTSW 12 69303613 missense possibly damaging 0.71
R6448:Klhdc2 UTSW 12 69303920 missense probably benign
R6848:Klhdc2 UTSW 12 69308976 nonsense probably null
R7824:Klhdc2 UTSW 12 69307228 missense probably damaging 0.98
R7844:Klhdc2 UTSW 12 69302406 missense probably damaging 1.00
R7886:Klhdc2 UTSW 12 69304632 splice site probably null
R7927:Klhdc2 UTSW 12 69302406 missense probably damaging 1.00
R7969:Klhdc2 UTSW 12 69304632 splice site probably null
RF016:Klhdc2 UTSW 12 69303886 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGGGATTCGCATTCTTTCCCCAAG -3'
(R):5'- TGCTCTCCTGAATGAGCAAGAGCC -3'

Sequencing Primer
(F):5'- TAAACAAggccccggcg -3'
(R):5'- CCTACTGACCTTGTAGCCG -3'
Posted On2015-02-04