Incidental Mutation 'R0724:Plcb3'
ID262020
Institutional Source Beutler Lab
Gene Symbol Plcb3
Ensembl Gene ENSMUSG00000024960
Gene Namephospholipase C, beta 3
Synonyms
MMRRC Submission 038906-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.664) question?
Stock #R0724 (G1)
Quality Score75
Status Validated
Chromosome19
Chromosomal Location6953714-6969759 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 6963392 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 359 (R359C)
Ref Sequence ENSEMBL: ENSMUSP00000025912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025912]
Predicted Effect probably damaging
Transcript: ENSMUST00000025912
AA Change: R359C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025912
Gene: ENSMUSG00000024960
AA Change: R359C

DomainStartEndE-ValueType
Pfam:EF-hand_like 225 316 6.6e-23 PFAM
PLCXc 317 468 4.26e-73 SMART
low complexity region 488 515 N/A INTRINSIC
low complexity region 553 578 N/A INTRINSIC
PLCYc 591 707 3.88e-76 SMART
C2 728 826 4.52e-14 SMART
low complexity region 917 936 N/A INTRINSIC
Pfam:PLC-beta_C 1029 1202 5.5e-57 PFAM
Meta Mutation Damage Score 0.9400 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphoinositide phospholipase C beta enzyme family that catalyze the production of the secondary messengers diacylglycerol and inositol 1,4,5-triphosphate from phosphatidylinositol in G-protein-linked receptor-mediated signal transduction. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for one targeted mutation die at E2.5 and exhibit poor embryonic organization and hypocellularity. Mice homozygous for a second targeted mutation survive to adulthood and exhibit an increased antinocieptive response to opioids. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 145,044,763 E136G probably benign Het
Adgre4 T A 17: 55,852,281 S655R probably benign Het
Ak7 T A 12: 105,710,254 V71E probably benign Het
Ank2 C T 3: 126,962,337 R1077H probably damaging Het
Anxa3 A G 5: 96,828,748 T198A possibly damaging Het
Atp1a1 A T 3: 101,592,439 I109N possibly damaging Het
Camta1 A G 4: 151,077,892 I119T probably damaging Het
Carm1 A G 9: 21,587,374 Y504C probably damaging Het
Casp1 C T 9: 5,303,077 P177L probably benign Het
Ccdc122 C A 14: 77,092,077 probably benign Het
Ces1a A G 8: 93,039,513 S158P probably damaging Het
Ces3a T A 8: 105,050,195 D103E possibly damaging Het
Clstn1 A C 4: 149,643,624 D583A possibly damaging Het
Corin A G 5: 72,332,795 probably benign Het
Cryba1 T C 11: 77,719,457 D144G probably damaging Het
Cwf19l2 G T 9: 3,421,377 probably null Het
Dis3l T C 9: 64,307,126 T1027A possibly damaging Het
Dopey2 A G 16: 93,762,325 E653G probably benign Het
Dst A G 1: 34,188,677 I1459V probably benign Het
Dyrk3 T C 1: 131,130,140 T64A probably benign Het
Emp2 C T 16: 10,284,615 C111Y probably benign Het
Enam A G 5: 88,501,994 Y454C probably damaging Het
Fbn1 A T 2: 125,352,064 C1328S probably benign Het
Gata3 T C 2: 9,874,575 T197A probably benign Het
Gm1043 A G 5: 37,187,229 T212A probably damaging Het
Gm15448 T C 7: 3,816,872 N564S possibly damaging Het
H2-Eb1 T C 17: 34,315,032 probably benign Het
Hand1 T C 11: 57,831,680 H36R probably damaging Het
Hmgcs2 C A 3: 98,297,001 Y239* probably null Het
Hoxc12 A G 15: 102,937,055 Y68C probably damaging Het
Inpp5a A G 7: 139,516,663 I143V probably benign Het
Klhdc2 C A 12: 69,297,048 F18L probably benign Het
Kpnb1 T C 11: 97,178,304 Y251C probably damaging Het
Lrch4 A T 5: 137,637,308 N315I probably damaging Het
Map3k10 A C 7: 27,668,355 V286G probably damaging Het
Myo7b G A 18: 32,005,549 probably benign Het
Nlrp2 G T 7: 5,319,222 L809I probably damaging Het
Oacyl T C 18: 65,737,825 probably benign Het
Olfr735 A G 14: 50,345,917 V175A possibly damaging Het
Paxbp1 T A 16: 91,036,536 D270V probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Plcxd3 G A 15: 4,516,868 S118N probably damaging Het
Ptpn14 T C 1: 189,850,947 S664P possibly damaging Het
Sirt1 T C 10: 63,323,973 I443V possibly damaging Het
Slc7a8 G A 14: 54,735,186 probably benign Het
Smim14 A G 5: 65,453,339 probably benign Het
Sost C T 11: 101,966,918 C19Y probably benign Het
Tcaf1 G T 6: 42,675,367 A727E probably damaging Het
Thoc1 T C 18: 9,963,829 L144P probably damaging Het
Tmem132b A T 5: 125,783,421 T577S possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tshr T C 12: 91,538,286 F666S probably damaging Het
Wdr1 A G 5: 38,540,862 V192A possibly damaging Het
Zfp697 T C 3: 98,428,166 W416R probably damaging Het
Other mutations in Plcb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Plcb3 APN 19 6955322 missense probably benign 0.27
IGL01370:Plcb3 APN 19 6962824 missense probably damaging 0.99
IGL01385:Plcb3 APN 19 6957908 missense probably benign
IGL01511:Plcb3 APN 19 6955843 missense probably damaging 0.99
IGL02182:Plcb3 APN 19 6969620 missense probably benign 0.22
IGL02240:Plcb3 APN 19 6958080 splice site probably benign
IGL02350:Plcb3 APN 19 6958178 missense probably damaging 1.00
IGL02357:Plcb3 APN 19 6958178 missense probably damaging 1.00
IGL02550:Plcb3 APN 19 6960176 nonsense probably null
IGL02866:Plcb3 APN 19 6957676 missense probably damaging 1.00
IGL03180:Plcb3 APN 19 6956153 missense probably benign 0.44
IGL03327:Plcb3 APN 19 6955052 missense probably benign
IGL03346:Plcb3 APN 19 6955052 missense probably benign
Multifarious UTSW 19 6954703 critical splice donor site probably null
R0042:Plcb3 UTSW 19 6966420 missense probably damaging 1.00
R0125:Plcb3 UTSW 19 6958908 missense probably damaging 1.00
R0240:Plcb3 UTSW 19 6962995 missense probably benign 0.16
R0240:Plcb3 UTSW 19 6962995 missense probably benign 0.16
R0781:Plcb3 UTSW 19 6961913 nonsense probably null
R0945:Plcb3 UTSW 19 6954878 missense probably damaging 1.00
R1110:Plcb3 UTSW 19 6961913 nonsense probably null
R1414:Plcb3 UTSW 19 6963017 missense probably damaging 1.00
R1454:Plcb3 UTSW 19 6955046 missense possibly damaging 0.64
R1533:Plcb3 UTSW 19 6957673 missense possibly damaging 0.70
R1652:Plcb3 UTSW 19 6955296 missense probably benign 0.00
R1795:Plcb3 UTSW 19 6956013 unclassified probably benign
R1870:Plcb3 UTSW 19 6962985 missense probably benign 0.04
R1934:Plcb3 UTSW 19 6964609 missense probably damaging 1.00
R3980:Plcb3 UTSW 19 6966435 missense probably damaging 1.00
R4397:Plcb3 UTSW 19 6965825 missense probably damaging 0.96
R4533:Plcb3 UTSW 19 6956272 missense probably benign 0.08
R4576:Plcb3 UTSW 19 6959047 splice site probably benign
R4815:Plcb3 UTSW 19 6962984 missense possibly damaging 0.59
R4903:Plcb3 UTSW 19 6955843 missense probably damaging 0.99
R5093:Plcb3 UTSW 19 6966210 missense probably damaging 1.00
R5555:Plcb3 UTSW 19 6966219 missense probably benign 0.19
R5593:Plcb3 UTSW 19 6954749 missense possibly damaging 0.94
R5626:Plcb3 UTSW 19 6955275 missense probably benign 0.24
R5661:Plcb3 UTSW 19 6963220 missense probably damaging 1.00
R5713:Plcb3 UTSW 19 6957692 missense probably damaging 0.99
R5741:Plcb3 UTSW 19 6954422 nonsense probably null
R6025:Plcb3 UTSW 19 6956179 missense probably benign 0.03
R6063:Plcb3 UTSW 19 6962834 missense possibly damaging 0.69
R6155:Plcb3 UTSW 19 6966165 missense probably damaging 1.00
R6157:Plcb3 UTSW 19 6966165 missense probably damaging 1.00
R6178:Plcb3 UTSW 19 6954703 critical splice donor site probably null
R7085:Plcb3 UTSW 19 6960133 missense possibly damaging 0.80
R7117:Plcb3 UTSW 19 6964378 missense probably damaging 1.00
R7134:Plcb3 UTSW 19 6965330 missense probably damaging 1.00
R7153:Plcb3 UTSW 19 6958084 critical splice donor site probably null
R7316:Plcb3 UTSW 19 6966385 critical splice donor site probably null
R7366:Plcb3 UTSW 19 6962021 missense probably benign
R7399:Plcb3 UTSW 19 6962867 missense probably benign
R7736:Plcb3 UTSW 19 6969623 missense probably benign 0.00
R8057:Plcb3 UTSW 19 6955095 missense probably benign
R8057:Plcb3 UTSW 19 6958899 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGTCGAGAGGGTCAATGAGCAGC -3'
(R):5'- ATCCACACTGACTGGAGGAGTGAG -3'

Sequencing Primer
(F):5'- TCTAGAGATTCCCAGGGCAG -3'
(R):5'- AGAGACTAGTATTGCCCTGGAATTG -3'
Posted On2015-02-04